JQuery :: BlockUI : Not Working When Html Page Is Loading Data?
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
ADVERTISEMENT
Oct 20, 2011
I'm sure this is simple to solve but I'm a newbie and I'm not sure what to do. I want to use the BlockUI plugin to show "page loading..." while my asp.net page loads some data - takes around 20 seconds. Once the page is fully loaded, I want the message to go away.
View 5 Replies
View Related
Jul 29, 2009
How would you load a separate page in an iframe with BlockUI? I tried: forceIframe:true, iframeSrc:'/iframepage.html' but BlockUI still creates the default "Please wait..." overlay, but also creates a seemingly separate iframe overlay, but without applying any of the CSS properties to it. If BlockUI doesn't have this functionality, so any of the other overlay plugins support it? I've tried jqModal and SimpleModal, but none of them seem to explicitly support this.
View 3 Replies
View Related
Mar 16, 2010
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
View 5 Replies
View Related
Feb 1, 2011
I noticed a slight usability bug with blockUI. when we block, with a message div - the page is still scrollable. however the message div that comes up, stays where it is, as user scrolls the page. So for example, if the vertical screen resolution is low, the user can not see the bottom of the message div, and in my case the message div has some appept or cancel buttons, which makes my UI unusable?
Are there any workarounds to this solution, other then placing the message div to the top of the page?
View 1 Replies
View Related
Oct 27, 2009
I am trying to block the whole page, but blockUI is not working with my layout (like the simple layout in demo).
View 1 Replies
View Related
Oct 19, 2009
I have this function:
<script language="javascript">
$(document).ready(function()
{
$("#place").change(function()
[code]....
I does work fine on firefox.. but as normal on IE does not load the result form types.php... .html(data) is not showing up.
View 1 Replies
View Related
Dec 28, 2010
I tried to load 1 html through ajax and javascript and it worked.But i want to load more than one and i cant.I thought that it would be a good idea to put the ajax files to the external websites and put the same load button.I tried this idea but it doesn work.I can only load one external website.
View 2 Replies
View Related
Feb 9, 2011
I have seen some posts similar to this, but don't think I've seen any resolutions; other than perhaps it cannot be done. Have a set of html files (each one a segment of a page -- not full with a head, etc.). Am using jQuery ajax on a click event to load appropariate html file into a holding div.I've used the $('#gpsDetArea').load method as well as the ajax method:
[Code]...
View 16 Replies
View Related
Jul 27, 2011
how can i get data ( a div) from an html page and put it in a different html page in a certain place? i can't get it to work !! i need something else i think!! i need it to load when i click on a link or a text am i missing something?? i've put the code in a click function but it doesn,t work...
[Code]...
View 1 Replies
View Related
Feb 15, 2012
I want to load data after loading related php page. i used ajax and even jquery.
jquery was not sure this is jquery code:
But this and when i was using ajax it changes data, but unfortunately, the pay now button (pay pal) was not working. curser changes but button don't work...
View 3 Replies
View Related
Jul 11, 2011
I stumbled across jQuery while during a search for my project that involves parsing and extracting content from HTML pages. I have a collection of xpath strings that identifies the data I would like to extract. Wondering if I could use jQuery for this purpose.
View 1 Replies
View Related
May 15, 2010
Something is up with my coding, when I try to load the page.. it will only load in notepad.
<html>
<head>
<title>Other ways to help</title>
<SCRIPT TYPE="text/javascript">
[Code].....
View 1 Replies
View Related
Apr 7, 2010
I have a html document with some jquery which is working fine...i pasted the same code in aspx page but its not working properly...i am not able to make out where the problem lies...
View 3 Replies
View Related
Aug 2, 2009
<html><head><style type="text/css"><!-- DIV {margin:0px;} --></style></head><body><div style="font-family:arial,helvetica,sans-serif;font-size:12pt">Hello
i'd like to know if it's possible change de message while the page is block by "blockUI" jquery plugin. I've tried a lot of things, but none was good. One thing i've tried was using CSS selectors like:
$('blockUI blockMsg blockPage').innerHTML
but it hasn't worked.
<font size="2"><span style="font-family: verdana,helvetica,sans-serif;"></span></font><div>
[Code].....
View 2 Replies
View Related
Jun 30, 2010
So here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.
View 1 Replies
View Related
Apr 26, 2011
I'm calling $.blockUI() whenever a anchor tag with a "link" class is clicked:
$("a.link").die("click").live("click", function()
{
$.blockUI();
});
The anchor click loads a new page, however, the unblocking of UI doesn't completely work. The overlay is removed, however, the cursor is not changing back to "normal". This is happening in Firefox 3.6.16. So, the end-user perceives the page as still processing because the cursor is "spinning". Moving the mouse will change the "wait" cursor back to the "normal" cursor.
View 3 Replies
View Related
Nov 18, 2010
I download the jquery library, when i include it as such:
It loads but i always get some sort of error in the functions in the page or something...as if the js is loaded but not correctly or as if it's missing, even though the download itself is correct
If i change the include path to (which is the exact same file i downloaded):
Everything works fine i am thinking maybe it could be something that has to do with encoding maybe? am not sure...any clue? it's only happening with the jquery JS files, the rest are working fine.
View 9 Replies
View Related
Jan 19, 2011
I want program code only using html and javascript. First I took one form and created some data on it like
name:xyz
address:hyderabad
country:india.
hobbies:reading,cooking.
submit button.Above is one simple form after submit i want it to display it in another page like out.html.
View 1 Replies
View Related
Nov 1, 2010
I am working on a simple tool for my office.We have a very huge database with 5000 tables. All the tables, Columns and their attributes are stored in to excel sheet.
Tool I am designing is for mapping between front end and back end values. Now I will use an image (front end screen of our application) , when user clicks it, I need the HTML to access the excel sheet and display the back end field,the name of tables it can be found in and other data related to that field
Simply,I want to pull data from excel and display them differently for each different click. I want to pass the parameter on click and filter a column in excel with it and display the entire set of sheet with this criteria. Is this possible? or am I expecting too much
View 5 Replies
View Related
Jan 26, 2009
I am passing an argument from the first page to the second using form "get" method.
My second html page is a dynamic page.So i couldn't retain the data which im getting from the first page because when the second page is refreshed the data is lost as the URL content is changed.
View 1 Replies
View Related
Oct 21, 2009
I have a site that is very jQuery and image heavy. The main sections of the site link to sections that are built with several Tabs, and as it loads, you briefly see all the content load and then it is hidden by the Tabs code.
The plan is to have a full window DIV that sits above all the content with a loading icon that plays until the entire page loads, and then it fades down.
After some hair pulling and research I have code in place that does exactly as I ask, however it does not seem to work in IE6+7. It works in all other browsers.
The current code is:
CSS for the loading DIV is:
A working link is [url]
View 1 Replies
View Related
Nov 16, 2010
Is it possible to group/ungroup data in a static HTML page, like you can in Excel?
I have a requirement to allow grouping/ungrouping of data like in Excel.
If it is not possible in a static HTML page, kindly suggest to me the best way to do it in order to get the same result in an HTML page
View 1 Replies
View Related
Jul 16, 2009
I am needing an accordion with dynamic data loading on each tier.
View 1 Replies
View Related
Aug 11, 2010
Apologies if this is a fairly simple question! I'm fetching data (from a MySQL database), and would like to show an animated loading image while the data is being downloaded, and obviously then hide it when the data is fully downloaded. I've found plenty of tutorials describing how to achieve this is the other direction (i.e. when submitting a form) but I'm not sure how to adapt these to what I want.
View 2 Replies
View Related
Jan 12, 2011
i had created a test page for showing a grid for a task demo. I am supposed to fill it with dummy data for now.i have been using jqgrid for quite some time and many of the pages are working on some live projects also,but today i was unable to populate the data from an array.i have created a test script for you people to see, here also i am facing the same problem, i dont remember what all was required to fill it as it has been quite some months since i worked on jquery.this is the link for the test page
View 2 Replies
View Related
