I have this function:
<script language="javascript">
$(document).ready(function()
{
$("#place").change(function()
[code]....
I does work fine on firefox.. but as normal on IE does not load the result form types.php... .html(data) is not showing up.
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
[URL]If you go to that site on Firefox, the "Return Code #" expands. But if you use IE, you'll see that it doesn't.I could add a fix in there for the fields if they were static, but if you see my javascript, they are dynamically loading fields.
This "class":"wide" is not working:
Code:
invoiceInput.appendChild(createElement("input", {"type":"text", "name":"invoice[]", "size":"8", "class":"wide;"}));
I am using a script I found on a jQuery board [URL] and it works for them, but not for me because my syntax is probably wrong. And they also are just using 1 field and not near-unlimited dynamically loading fields like I am.How would I add in a fix to have the browser 'only' use the expansion if the user is using IE6 or IE7?
[URL]...If you go to that site on Firefox, the "Return Code #" expands. But if you use IE, you'll see that it doesn't. I could add a fix in there for the fields if they were static, but if you see my javascript, they are dynamically loading fields. This "class":"wide" is not working:
Code:
invoiceInput.appendChild(createElement("input", {"type":"text", "name":"invoice[]", "size":"8", "class":"wide;"}));
I am using a script I found on a jQuery board [URL]..and it works for them, but not for me because my syntax is probably wrong. And they also are just using 1 field and not near-unlimited dynamically loading fields like I am. How would I add in a fix to have the browser 'only' use the expansion if the user is using IE6 or IE7?
I have a html file that I want to load, loop through the json data and for each json entry I want to add a new block of the html and insert the json data into the matching div/class of the html. json looks like this:
{"Super" : [{"Name" : "John Doe", "Age" : "30"}, {"Name" : "Jane Doe", "Age" : "40"}]};
html looks like this:
<div class="Name"></div><div class="Age"></div>
So for each json entry of name/age, I want to insert that into the html, and then add another row, until all json data has been fetched. After this I want to insert all of this into #box, which is just a divthat should contain that html. Looping like this obviously does not work, since I just keep replacing the same html through the loop.
var jsonData = {"Super" : [{"Name" : "John Doe", "Age" : "30"}, {"Name" : "Jane Doe", "Age" : "40"}]};
$.each(json.Super, function() {
$('#box .Name').html(this.Name);
$('#box .Age).html(this.Age);
});
i am trying to pass text from one select box to another select box. The logic is if 10 are added, no more passing must happen. Also if an item is already added, it mustn't be added again.I am using the for loop to check the existence of an item but it is not working: what am i doing wrong?
Code:
function PassSelectValues(){
//pass values from select boxes to select boxes
var counter;[code]....
why isn't counter incrementing at all? The alert message box does appear saying item exists but the item gets added anyway.
I am doing something like the following:
var set = $('div#this_one');
var next_sibs = set.nextAll();
for (var i = 0; i < sibs.length; ++i)
[code]....
When I look at the variables in FireBug, they are as expected; but when I look at the results in the HTML page the value retains its original value.
I have a select that is populated from a mysql database, and I have a text input that if your option isn't listed, you can add it and it should add to the table that is populating the initial select. And I want to do it all without reloading the page, which is where jQuery comes in. Now, I've managed to have the text input add to the database without problems and echo back a "success" statement using ajax(). But I'm kind of lost on how to tell it to reload the data in the select.
[Code].....
I think I need to do something on success, but I'm kind of lost for what I should do. I thought about using load() and just having another php file that basically replaces the current select with the same thing; but it would show the newer data having just been called, but that seems like it's a crass way to handle it. I feel like there should be a way to say "run that mysql statement again" on success but my google foo is failing me.
how can i get data ( a div) from an html page and put it in a different html page in a certain place? i can't get it to work !! i need something else i think!! i need it to load when i click on a link or a text am i missing something?? i've put the code in a click function but it doesn,t work...
[Code]...
i have something questions. how can i select element from another page for processing data. ex : #myname.value from content.php and i will process that value to the process.php.
View 2 Replies View RelatedI am using JQuery Mobile . I have populated Select box with dynamic data, The UI shows just one item populated, rest does not get rendered , here's code. The option loop iterates 5 times but the select box just show one item when renderd. Is it Jquery mobile the select box cannot be populated dynamically?
var options ='';
$("#select-choice-1").empty().append(function() {
$.each(data.maps,function(key, value){
options += '<option value="' + i + '">' + value + '</option>';
[Code]....
I'm trying to grab a variable from a URL and dynamically embed it into HTML code. So for instance, if I own the site test.com and I enterideo=bunny.mp4&height=720&width=480",I want the returned page to be an embedded video of bunny.mp4 at the height and width specified. I know the embed code, I just need to know how to parse the URL and write it inside of the HTML.
View 11 Replies View Related$('#food_rate').load('/ajax.php?x=get_food');
$('#tax_rate').load('/ajax.php?x=get_tax');
$('#mood').html(function(){
return ($('#food_rate').html()-$('#tax_rate').html())*10;
});
$('#mood').html always contains the value of the values food_rate and tax_rate had before I loaded the new values in. (Before Line 1 and 2 happen)I already red, about event bubbling and event delegation, but the html-elements fax_rate and food_rate exist from the beginning, and only their innerHTML does change.
I stumbled across jQuery while during a search for my project that involves parsing and extracting content from HTML pages. I have a collection of xpath strings that identifies the data I would like to extract. Wondering if I could use jQuery for this purpose.
View 1 Replies View RelatedI have a table that displays a list of groups. You can add, modify, or remove the group. I have three functions in my JS:
[Code]...
Using AJAX, PHP, and jQuery, when I add a group, it posts to an "addgroup.php" file, and then returns that data in JSON format, and I then tell jQuery to display that data in HTML. Here's the problem now... The table does not render properly. There is no padding/margins. Even worse, if I Add a group, and then click the "X" to delete the group (without refreshing the page), the data posts, and returns (i get a response in my console confirming the removal), but the entry that I just added does not disappear (as it should) unless I refresh the page. When I add a group, and then view my page source and inspect the element, all of the appropriate HTML is there, but it just doesn't seem to be rendering right.
I want to set a chek box, and it will checked if data found from database and non checked if data is not found from data base ,yes this is i know but think is that ,if it checked it show some html data in another div like <div id="name"></div>
View 4 Replies View RelatedI want to post some HTML (contained in a div on the page) data using jQuery using $.ajax() method. But it is not working.
<script language="javascript" type="text/javascript">
function PostHTMLContentTOServer() {
var pageData = document.getElementById
("MainDiv").innerHTML;
[Code]....
I have a textbox and button in html, and when something is fill in the textbox, i want to pass the value of the textbox to ajax, data: '{"name": theName}', I couldn't seems to get it to work.
Of couse when i use string value, it works just perfectly for example: data: '{"name":
"Joe"}',
HTML Code
<input type="text" id="theName" name="theName" value="" />
<input id="callAjax" type="button" value="Submit" />
<script type="text/javascript" src="Default.js">
</script>
[Code].....
I am having some problems to solve what i will explain next:
I am reading a xml into a html table code...
This code only give me the textboxes that have values and the correspondent value.
What can i do to have more than the value of the textbox, ie, return the value of that and the value of another column in the same row?
how do I get the post data from html in jQuery which contains square brackets?
[code]........
I was trying to get the tablesorter plugin working. I'm not working with flat data, but with database-data appended to a div by javascript. The tablesorter plugin is working with flat HTML data, but no with that dynamic data.
View 1 Replies View RelatedI built a pretty simple Ajax request which needs to send some data to the server and put the resulting HTML in a div. Unforunately, I need to POST the data. I used .post() and it worked fine ... *on Chrome and Opera!* ... on Firefox no data gets posted even though firebug shows the data in it's console. I ended up building the longest possible request, just to try all the options. No luck. As soon as I POST anything, Firefox won't receive the data. If this was a Firefox issue, wouldn't I read about it everywhere? What's wrong?
View 2 Replies View RelatedSo here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.
View 1 Replies View RelatedI am having data in table. There is an checkbox in each row . I want checked rows to be exported to excel file when user click export button.
View 2 Replies View RelatedI have multiple rows of data in an HTML table. E.g., financial transactions. In each row I have an HTML dropdown SELECT with options (user will select transaction tag). I want the transactionID and selected tagID to pass to an onchange event for that unique row. The transactionID comes through for the unique row of data, but I
[Code]...
I am trying to create 3 boxes with 2nd select box content to be uploaded on the basis of value selected in first box and third box list should be uploaded on the basis of value selected in 2nd box.i have written coding for that as below but it is not working .
<html>
<head>
<title>Search Website</title>[code].....
