how can i get data ( a div) from an html page and put it in a different html page in a certain place? i can't get it to work !! i need something else i think!! i need it to load when i click on a link or a text am i missing something?? i've put the code in a click function but it doesn,t work...
[Code]...
I stumbled across jQuery while during a search for my project that involves parsing and extracting content from HTML pages. I have a collection of xpath strings that identifies the data I would like to extract. Wondering if I could use jQuery for this purpose.
View 1 Replies View RelatedI have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
So here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.
View 1 Replies View RelatedI want program code only using html and javascript. First I took one form and created some data on it like
name:xyz
address:hyderabad
country:india.
hobbies:reading,cooking.
submit button.Above is one simple form after submit i want it to display it in another page like out.html.
I am working on a simple tool for my office.We have a very huge database with 5000 tables. All the tables, Columns and their attributes are stored in to excel sheet.
Tool I am designing is for mapping between front end and back end values. Now I will use an image (front end screen of our application) , when user clicks it, I need the HTML to access the excel sheet and display the back end field,the name of tables it can be found in and other data related to that field
Simply,I want to pull data from excel and display them differently for each different click. I want to pass the parameter on click and filter a column in excel with it and display the entire set of sheet with this criteria. Is this possible? or am I expecting too much
I am passing an argument from the first page to the second using form "get" method.
My second html page is a dynamic page.So i couldn't retain the data which im getting from the first page because when the second page is refreshed the data is lost as the URL content is changed.
Is it possible to group/ungroup data in a static HTML page, like you can in Excel?
I have a requirement to allow grouping/ungrouping of data like in Excel.
If it is not possible in a static HTML page, kindly suggest to me the best way to do it in order to get the same result in an HTML page
I am writing a small data entry screen that will post the form data to a page and return a message. But i cannot get the Success or Error functions working properly.
Here's the code where strData is the posted querystring of:
I'm not sure whether it should be in a form and using the onsubmit or click of a button.
I have a html file that I want to load, loop through the json data and for each json entry I want to add a new block of the html and insert the json data into the matching div/class of the html. json looks like this:
{"Super" : [{"Name" : "John Doe", "Age" : "30"}, {"Name" : "Jane Doe", "Age" : "40"}]};
html looks like this:
<div class="Name"></div><div class="Age"></div>
So for each json entry of name/age, I want to insert that into the html, and then add another row, until all json data has been fetched. After this I want to insert all of this into #box, which is just a divthat should contain that html. Looping like this obviously does not work, since I just keep replacing the same html through the loop.
var jsonData = {"Super" : [{"Name" : "John Doe", "Age" : "30"}, {"Name" : "Jane Doe", "Age" : "40"}]};
$.each(json.Super, function() {
$('#box .Name').html(this.Name);
$('#box .Age).html(this.Age);
});
I need to have a simple text input field on a html page. It needs the users to type in either:
And depending on whats entered this will then take them to the corresponding:
Is this possible with javascript?
I am doing something like the following:
var set = $('div#this_one');
var next_sibs = set.nextAll();
for (var i = 0; i < sibs.length; ++i)
[code]....
When I look at the variables in FireBug, they are as expected; but when I look at the results in the HTML page the value retains its original value.
I'm trying to grab a variable from a URL and dynamically embed it into HTML code. So for instance, if I own the site test.com and I enterideo=bunny.mp4&height=720&width=480",I want the returned page to be an embedded video of bunny.mp4 at the height and width specified. I know the embed code, I just need to know how to parse the URL and write it inside of the HTML.
View 11 Replies View RelatedI have this function:
<script language="javascript">
$(document).ready(function()
{
$("#place").change(function()
[code]....
I does work fine on firefox.. but as normal on IE does not load the result form types.php... .html(data) is not showing up.
$('#food_rate').load('/ajax.php?x=get_food');
$('#tax_rate').load('/ajax.php?x=get_tax');
$('#mood').html(function(){
return ($('#food_rate').html()-$('#tax_rate').html())*10;
});
$('#mood').html always contains the value of the values food_rate and tax_rate had before I loaded the new values in. (Before Line 1 and 2 happen)I already red, about event bubbling and event delegation, but the html-elements fax_rate and food_rate exist from the beginning, and only their innerHTML does change.
I have a table that displays a list of groups. You can add, modify, or remove the group. I have three functions in my JS:
[Code]...
Using AJAX, PHP, and jQuery, when I add a group, it posts to an "addgroup.php" file, and then returns that data in JSON format, and I then tell jQuery to display that data in HTML. Here's the problem now... The table does not render properly. There is no padding/margins. Even worse, if I Add a group, and then click the "X" to delete the group (without refreshing the page), the data posts, and returns (i get a response in my console confirming the removal), but the entry that I just added does not disappear (as it should) unless I refresh the page. When I add a group, and then view my page source and inspect the element, all of the appropriate HTML is there, but it just doesn't seem to be rendering right.
I have this normal HTML page, starts with <!DOCTYPE ...... and end with </html>, nothing special, what I need is to get every character from the beginning to the end.I've tried $("html").html(), but this cannot get the <!DOCTYPE line and also the <html> line, but only the codes inside the <html> tag, how can I get all ?
View 1 Replies View RelatedI want to set a chek box, and it will checked if data found from database and non checked if data is not found from data base ,yes this is i know but think is that ,if it checked it show some html data in another div like <div id="name"></div>
View 4 Replies View RelatedI want to post some HTML (contained in a div on the page) data using jQuery using $.ajax() method. But it is not working.
<script language="javascript" type="text/javascript">
function PostHTMLContentTOServer() {
var pageData = document.getElementById
("MainDiv").innerHTML;
[Code]....
I have a textbox and button in html, and when something is fill in the textbox, i want to pass the value of the textbox to ajax, data: '{"name": theName}', I couldn't seems to get it to work.
Of couse when i use string value, it works just perfectly for example: data: '{"name":
"Joe"}',
HTML Code
<input type="text" id="theName" name="theName" value="" />
<input id="callAjax" type="button" value="Submit" />
<script type="text/javascript" src="Default.js">
</script>
[Code].....
I am having some problems to solve what i will explain next:
I am reading a xml into a html table code...
This code only give me the textboxes that have values and the correspondent value.
What can i do to have more than the value of the textbox, ie, return the value of that and the value of another column in the same row?
how do I get the post data from html in jQuery which contains square brackets?
[code]........
I built a pretty simple Ajax request which needs to send some data to the server and put the resulting HTML in a div. Unforunately, I need to POST the data. I used .post() and it worked fine ... *on Chrome and Opera!* ... on Firefox no data gets posted even though firebug shows the data in it's console. I ended up building the longest possible request, just to try all the options. No luck. As soon as I POST anything, Firefox won't receive the data. If this was a Firefox issue, wouldn't I read about it everywhere? What's wrong?
View 2 Replies View RelatedI am having data in table. There is an checkbox in each row . I want checked rows to be exported to excel file when user click export button.
View 2 Replies View RelatedI have multiple rows of data in an HTML table. E.g., financial transactions. In each row I have an HTML dropdown SELECT with options (user will select transaction tag). I want the transactionID and selected tagID to pass to an onchange event for that unique row. The transactionID comes through for the unique row of data, but I
[Code]...
I am developing a web application in java (jsp's and servlets). For the project I am working on I will need to develop an html data entry screen and the code to load data into the screen, and then save the data back to the back-end database.
How to do the following:
Read the data out of the database (JDBC, no problem) in a servlet.
Put the data into the appropriate form for returning to the data entry screen, which will be a jsp. (Is JSON the right choice for passing the data from the servlet to the jsp?)
In the jsp, parse the returned data and populate the HTML form elements (text fields and combo boxes). When a button is clicked, pull the data out of the form elements and return to a servlet for saving back in the database.
