I want program code only using html and javascript. First I took one form and created some data on it like
name:xyz
address:hyderabad
country:india.
hobbies:reading,cooking.
submit button.Above is one simple form after submit i want it to display it in another page like out.html.
I am facing some problem with this when i am trying to sent the data in krnlAddComment1.asp page and there is only an insert query exists. after run the query successfully, response.write "...." revert back to me
if ((myname != null) && (comm != null) && (captcha1 == randomnum))
So my problem is that i can't send form data in FF without page refresh (though in IE7-8 everything works smoothly).
My code fragments:
Well i do have a mysql query in one php page(php_1) & I want to submit the variables to the query in different php page(php_2) via form action but how am I supposed to do it without redirecting to php_1..All I need is to post the data to the first php page query so that It performs some action over there & thats all... So hoping sumone who knows ajax might helpme out with a sample code or point me in the right direction.
php_1 page :-
$query = ("SELECT * FROM state4 WHERE (LONG_HI<'".$_POST['Ymax']."')");
php_2 page:-
[code].....
A page I'm working on lets users open a new window, which in turn lets them send data back to the parent page to create new table rows, cells, links, etc. One of the links created is "delete", so it should delete the row that the delete link belongs to when clicked on. I can do this no problem in ff using the setAttribute('onclick',onClickEvent), but can't do this in IE. I'll show some code to make this easier to understand....
[Code]....
I have an webbpage, and in the middle of it there is an iframe to a php site. So i have used this code, so after some seconds the iframe will send the guest to another page. <meta http-equiv="refresh" traget="_top" content="5 url=http://mypage.com"/> But the thing is that i want the WHOLE page to reload, and go to that page after 5 seconds (we can say). With that code, only the iframe are going to another page. Is it possible to make the whole page send the user after some seconds, to another page and not only the iframe?
View 1 Replies View Relatedhow can i get data ( a div) from an html page and put it in a different html page in a certain place? i can't get it to work !! i need something else i think!! i need it to load when i click on a link or a text am i missing something?? i've put the code in a click function but it doesn,t work...
[Code]...
how to send data to MS-Excel sheet from HTML form with javascript. It should be done in javascript not java.
View 5 Replies View RelatedI stumbled across jQuery while during a search for my project that involves parsing and extracting content from HTML pages. I have a collection of xpath strings that identifies the data I would like to extract. Wondering if I could use jQuery for this purpose.
View 1 Replies View RelatedI am working on a simple tool for my office.We have a very huge database with 5000 tables. All the tables, Columns and their attributes are stored in to excel sheet.
Tool I am designing is for mapping between front end and back end values. Now I will use an image (front end screen of our application) , when user clicks it, I need the HTML to access the excel sheet and display the back end field,the name of tables it can be found in and other data related to that field
Simply,I want to pull data from excel and display them differently for each different click. I want to pass the parameter on click and filter a column in excel with it and display the entire set of sheet with this criteria. Is this possible? or am I expecting too much
I am passing an argument from the first page to the second using form "get" method.
My second html page is a dynamic page.So i couldn't retain the data which im getting from the first page because when the second page is refreshed the data is lost as the URL content is changed.
I built a pretty simple Ajax request which needs to send some data to the server and put the resulting HTML in a div. Unforunately, I need to POST the data. I used .post() and it worked fine ... *on Chrome and Opera!* ... on Firefox no data gets posted even though firebug shows the data in it's console. I ended up building the longest possible request, just to try all the options. No luck. As soon as I POST anything, Firefox won't receive the data. If this was a Firefox issue, wouldn't I read about it everywhere? What's wrong?
View 2 Replies View RelatedIs it possible to group/ungroup data in a static HTML page, like you can in Excel?
I have a requirement to allow grouping/ungrouping of data like in Excel.
If it is not possible in a static HTML page, kindly suggest to me the best way to do it in order to get the same result in an HTML page
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
So here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.
View 1 Replies View RelatedI need to have a simple text input field on a html page. It needs the users to type in either:
And depending on whats entered this will then take them to the corresponding:
Is this possible with javascript?
I've been searching for a few hours and haven't been able to find a code snippet to see if this is available. I'm attempting to pass text from my website to another website that has a form setup on it. I'd like to fill in the pertinent data for my users on the page that I load for them. I cannot make any changes to the receiving page as it is run by another company. I've pasted some of the code that is available on the receiving form.
<script type="text/javascript">
//<![CDATA[
var theForm = document.forms['form1'];
if (!theForm) {
[Code]....
I am currently programming Script Adds data to the database but if i want to Shown the data that have been added Requires refresh the page to show the Data that have been added . and I do not want this method.I want to when adding data to show updates as soon as the addition of data.This can be done by Ajax , and An example of this method used Google Gmail.
View 3 Replies View RelatedHow can have a form.htm in a webpage page and send it to the action page without reloading the whole page using javascript? Form.php
[Code].....
I am working on a page that will load in other pages using AJAX and the .html method. Something like this :
<span id = "edit">Edit</span>
<div id = "cont">
</div>
//the click edit script
[Code]....
Unfortunately this does not seem to work, entirely. It does trigger the click event but it messes up the post for some reason. I have played around with it for the last 45 minutes or so and it seems like the click event trigger is what is messing things up, if I comment it out it works fine. Could anyone tell me why they think this is? note this is an over simplified version of my actual code, but the structure is the same.
On my webpage, I dynamically create an iFrame when a button is pressed, then load a html page from within my own domain into the iframe, based on what html page is loaded into a variable. My question is, can I dynamically change the font family of the loaded html page from the javascript of the main page? My code to create the iframe is:
function setSubTxt(){
var par = document.getElementById('parentDiv');
par.innerHTML = '<iframe src="'+subTxt+'" style="width: 375px; position: fixed; height: 365px; left: 400px; top: 145px; border=none;" name="subIframe" frameBorder=0></iframe>';
frames['subIframe'].window.location=subTxt;
document.subIframe.document.body.style.fontFamily = "Arial";
[Code]....
the variable "subTxt" has the url of the html page to be loaded (always on the same domain). The code: document.subIframe.document.body.style.fontFamily = "Arial"; was my attempt to dynamically change the font, but it didn't work. Also, it should be noted that there is no font family set in the html pages which would override this.
I have an html page that uses javascript to open a new window and
display a file that gets created when a button is pressed.
My problem is when the file is changed and the display button is
pressed, the old file is still displaying. I have tried using
<META HTTP-EQUIV=expires CONTENT=0><META HTTP-EQUIV=PRAGMA CONTENT=NO-CACHE>, but doesn't work 100% of the time.
I would the user of my website to click a link on a page and for some information to display on the page without a reload of the page. This is what I would like to happen in my specific case:The user clicks the name of the cd and the full track list and a small image displays above it, without going to a new page.
View 2 Replies View RelatedI have a html document when i run in Internet explorer i am getting the desired output(j query working fine). But i copy pasted the same code in aspx page...the same code is not working properly...
View 9 Replies View Relatedsend page by email displays everything in my page including hidden elements, is there a way to avoid this?
View 1 Replies View RelatedHow to test if a html page has a parent page?Let me explain: I use the (great) Colorbox plugin and I like to apply jquery functions only if a page is in an Colorbox iframe.So, basically, I'd like to know how to determine with jQuery if a page has a parent page (= is in a Colorbox iframe).
View 2 Replies View Related