JQuery :: Extract Data From HTML Page?

Jul 11, 2011

I stumbled across jQuery while during a search for my project that involves parsing and extracting content from HTML pages. I have a collection of xpath strings that identifies the data I would like to extract. Wondering if I could use jQuery for this purpose.

View 1 Replies


ADVERTISEMENT

JQuery :: Extract Condense Of A Html Page Using It?

Oct 8, 2011

I need to get the innerHtml details of a page .in the below script when i alert the obj iam getting the Text of Html i need to get the inner html object how it is possible.[code]...

View 4 Replies View Related

Extract Part Of Html Page

Jul 23, 2005

I'm trying to write a widget for Mac OSX Tiger. Here's the problem: The
user enters a search term which is sent to a perl script on a remote
server. This script returns a fully formatted HTML page. I only want
part of that page to be displayed. How do I go about doing this?

View 2 Replies View Related

AJAX :: Extract Ist Paragraph From HTML Page

Jun 22, 2010

I am developing an application using AJAX and CSS. I have a webpage in which i have some hyperlinks. I want that when ever some one move the cursor on some link, than mini preview should be loaded before clicking. I have done that but problem is that i want just the ist paragraph of the target webpage not the whole page. I dont want images in my preview window.

View 3 Replies View Related

Regular Expression :: Extract Only Numbers From An HTML Page

Jul 23, 2005

I'm looking to use Javascript to pull apart a page of HTML I have
already fetched. The page contains a table, within which there are rows
containing...

Either:

0000000 - 0000000<some html>00<some html>0

or:

0000000 - 0000000<some html>00 - 00<some html>0

I'm interested in extracting only the numbers (which may not always be
0!), in each case. I bet this can be done using a regular expression (or
two). Can anyone help?

View 5 Replies View Related

JQuery :: How To Extract A Data From A URL

Oct 22, 2010

I need to extract some data from the following block:<span <aref="localhost:80/items/2">item link</a> <span>item attribute</span></span> I can get the item link anditem attributedata by using $("span a") and$("span span"). I, however, can't figure out how to extract the "2" from the "localhost:80/items/2".

View 4 Replies View Related

JQuery :: Extract Data From This JSON Encode?

Jun 25, 2009

I have this JSON file that does the encoding from the states database.I want to extract it out using jquery and populate the select dropdown box. the json file is being encoded in this way:

[
{"State":{"name":"AUSTRALIA CAPITAL TERRITORY"}},
{"State":{"name":"NEW SOUTH WALES"}},

[code]....

View 5 Replies View Related

JQuery :: Extract A Part Of Received Data?

Sep 17, 2009

I try to load only a part of my data file (named Elements.html).

[Code]...

View 6 Replies View Related

JQuery :: Strings - Extract Data From A Textfield ?

Mar 31, 2010

To manipulate strings, but forexample when Iam programming an event with jquery and extract data from a textfield for example I can,t do this var msg=msg.subtring(0,5);

Or for example this does not work->

View 2 Replies View Related

JQuery :: Data From Html Page To Another

Jul 27, 2011

how can i get data ( a div) from an html page and put it in a different html page in a certain place? i can't get it to work !! i need something else i think!! i need it to load when i click on a link or a text am i missing something?? i've put the code in a click function but it doesn,t work...

[Code]...

View 1 Replies View Related

JQuery :: BlockUI : Not Working When Html Page Is Loading Data?

Aug 9, 2010

I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area

>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG

[code]....

View 2 Replies View Related

JQuery :: Dynamically Load Data Driven Html Page?

Jun 30, 2010

So here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.

View 1 Replies View Related

Extract Data From Each Cell In Table?

Apr 29, 2010

I would have "thought" it would be a simple thing to get the (unformatted) text in each cell of a dynamic table but I have failed to solve this problem. So...I have a table that the user can dynamically load with data. They click an add button to insert a row in a table which includes a delete button per row if they want to turn around and delete it.The table is inside a form. When they submit the form, I need to read each row and each cell in a row in order to dump it into some format so that the table contents display reasonably well in the email that is sent from the form submission.So the add row function looks like:

function addRow() {
//add a row to the rows collection and get a reference to the newly added row
var newRow = document.all("mytbl").insertRow();

[code]....

View 3 Replies View Related

Extract Data From One Row In A Dynamically Created Table?

Aug 12, 2010

i am creating a table dynamically using java script- the number of cells in a row is constant and the data is accepted from the user from x text boxes(based on number of cells).now, i want to insert a button in the x+1th cell of each row and i want to extract the data in the row that contains the button that gets clicked back into the text boxes for editing.how do i go about doing this? dynamically creating the table is not a problem, but am not able to extract the row data for editing :-(i forgot to mention this- but after editing the data in the text box, i need to be able to insert the data back into the same row from which the data was extracted in the first place...

View 3 Replies View Related

Send Data From Page To New Page Only In Html?

Jan 19, 2011

I want program code only using html and javascript. First I took one form and created some data on it like

name:xyz
address:hyderabad
country:india.
hobbies:reading,cooking.

submit button.Above is one simple form after submit i want it to display it in another page like out.html.

View 1 Replies View Related

Extract Filename Of Html

Jun 17, 2007

This is a simple script I though of to get the filename of container for html.

Note: this only is tested on mozilla firefox 2 on windows vista

document.write("<a style='display:none' id='zFilenameFinder1' href=''>q</a>");
document.write("<a style='display:none' id='zFilenameFinder2' href='b'>q</a>");
var zDocURL = document.getElementById('zFilenameFinder1').href;
var zCompareURL = document.getElementById('zFilenameFinder2').href;
zCompareURL = zCompareURL.replace('b','');
var zFilename = zDocURL.replace(zCompareURL, '');
alert(zFilename)//filename handler


it works by creating two relative urls. one's href is blank, which when called by link.href returns the absolute value, giving the absolute link the page, then you compare it to a link that has a relative href of "b" which can be compared to the other link to give you the whole url

View 2 Replies View Related

How To Extract Html Text?

Sep 18, 2006

How would I extract all the text elements in the html page.

I need all the words that are viewable in a html page in array..

how easily this could be achieved..

View 3 Replies View Related

Extract Coding From Html File?

Jun 2, 2011

How to extract javascript coding from a html file?

View 1 Replies View Related

How To Read Excel/mdb Data Using HTML Page

Nov 1, 2010

I am working on a simple tool for my office.We have a very huge database with 5000 tables. All the tables, Columns and their attributes are stored in to excel sheet.

Tool I am designing is for mapping between front end and back end values. Now I will use an image (front end screen of our application) , when user clicks it, I need the HTML to access the excel sheet and display the back end field,the name of tables it can be found in and other data related to that field

Simply,I want to pull data from excel and display them differently for each different click. I want to pass the parameter on click and filter a column in excel with it and display the entire set of sheet with this criteria. Is this possible? or am I expecting too much

View 5 Replies View Related

Retain Data In Html Page When It Is Refreshed?

Jan 26, 2009

I am passing an argument from the first page to the second using form "get" method.

My second html page is a dynamic page.So i couldn't retain the data which im getting from the first page because when the second page is refreshed the data is lost as the URL content is changed.

View 1 Replies View Related

AJAX :: How To Extract Part Of HTML From Response

Apr 28, 2010

I'm trying to come up with what is probably a kludge. What I'd like to do is take the responseText from an AJAX request -- which will be a full HTML page -- and parse it first to find if there is a <form>...</form> in it. If not I'll display a success message and all is fine, but if it's there, then I want to extract just that form section and display it within a <div> in the page.

This is where my JS skills are failing me. Can anyone point me to the applicable functions, tutorial, or whatever that would show me how to find the <form> and extract it and then replace my div contents with it (just innerHTML?).

View 3 Replies View Related

Group/ungroup Data In The HTML Page Like In Excel?

Nov 16, 2010

Is it possible to group/ungroup data in a static HTML page, like you can in Excel?

I have a requirement to allow grouping/ungrouping of data like in Excel.

If it is not possible in a static HTML page, kindly suggest to me the best way to do it in order to get the same result in an HTML page

View 1 Replies View Related

Extract The Data Inside The "error" Tag?

Mar 23, 2011

function callBackFunctionForAddAdmin(data)
{
alert(data);

}

If we get the following alert message

<result><error>the given userid is already admin.please enter another one.. </error></result>

How do i extract the data inside the "error" tag?? (first checking if it exists and then if so extracting it)

View 1 Replies View Related

JQuery :: Success - Error - Small Data Entry Screen - Post Form Data To A Page And Return A Message

Jul 22, 2011

I am writing a small data entry screen that will post the form data to a page and return a message. But i cannot get the Success or Error functions working properly.

Here's the code where strData is the posted querystring of:

I'm not sure whether it should be in a form and using the onsubmit or click of a button.

View 2 Replies View Related

JQuery :: Load Html And Loop Through Json While Changing Html With Json Data?

Sep 11, 2010

I have a html file that I want to load, loop through the json data and for each json entry I want to add a new block of the html and insert the json data into the matching div/class of the html. json looks like this:

{"Super" : [{"Name" : "John Doe", "Age" : "30"}, {"Name" : "Jane Doe", "Age" : "40"}]};
html looks like this:
<div class="Name"></div><div class="Age"></div>

So for each json entry of name/age, I want to insert that into the html, and then add another row, until all json data has been fetched. After this I want to insert all of this into #box, which is just a divthat should contain that html. Looping like this obviously does not work, since I just keep replacing the same html through the loop.

var jsonData = {"Super" : [{"Name" : "John Doe", "Age" : "30"}, {"Name" : "Jane Doe", "Age" : "40"}]};
$.each(json.Super, function() {
$('#box .Name').html(this.Name);
$('#box .Age).html(this.Age);
});

View 3 Replies View Related

Password To Page.html - Simple Text Input Field On A Html Page

Jun 27, 2010

I need to have a simple text input field on a html page. It needs the users to type in either:

And depending on whats entered this will then take them to the corresponding:

Is this possible with javascript?

View 1 Replies View Related







Copyrights 2005-15 www.BigResource.com, All rights reserved