I am passing an argument from the first page to the second using form "get" method.
My second html page is a dynamic page.So i couldn't retain the data which im getting from the first page because when the second page is refreshed the data is lost as the URL content is changed.
I need to refresh a div which contains an ad while the rest of the page stays the same. I think I'm pretty close by reading the previous posts on this site, but one odd thing is tripping me up and I can't figure out why. When I call my function to refresh the div, it replaces everything on the page instead of just swapping out the div. Code:
View 6 Replies View RelatedI ma having an issue with a JavaScript slider. If you look at this page, at times the slider does not work and the user is having to refresh their page before it works. It's the same in Firefox and IE.[url]...
View 10 Replies View RelatedOn IE6 how to retain page position after a button click or page reload?.
View 6 Replies View RelatedI'm new to javascript and im trying to add a close button function to my certain pages of my site. I use this code:
<a href='javascript:window.close();'>Close Window</a>
to create a hyperlink which closes the window. However with pages which
display data retrieved from a database using PHP i use a form to submit
a search on the page which displays results. At the bottom of the page
is the close window link, however it fails to work once a form has been
submitted on the page. It only works when the page first loads.
Any ideas guys on how i can get a close window option that works on my
results page after submitting a search?
Is there a method to check if a user refreshed a page?
I'm designing an online psychological experiment and I want to see if the user refreshed a page (to see if he was trying to see an image that he was supposed to see only once).
I am very new to javascript so I'm sorry if this is a stupid question. I made this page by pecing scripts together that I found online. I don't even know if this is the best way to get my desired results. I want the background to fill up the entire window, as well as the text and link to remain on the bottom in their respective corners and also re-size with the window. The code doesn't work the first time the page is loaded, but it works fine after it is refreshed. Do y'all have any suggestions on how to fix this.
View 1 Replies View RelatedI have several switch menus that are VITAL to my website's navigation. They all worked very well when I tested the pages in all browsers. However, I finally FTPed my site to the internet, now when you click a link from a switch menu, instead of staying opened due to the onLoad function in the body, they do not appear.
Strangely, the only way to get my switch menus to show is to refresh the page.
Apologies for the almost duplicate post but thought this was much
clearer description of the issue than what I originally posted.
I'm trying to do simple integration with a third-party
web application. The app has an 'Action' button on all pages that
can be associate with a JS function. Our application is very
proficient at parsing text provided it is in some reasonably standard structure.
Is what we are trying to do is have a JS function that can be called
from any page in their system that will provide a reasonable representation
of the text on the screen. I need something close to document.body.innerText; the problem with this function is that it strips spacing from tables so we can't get consistent layout.
The consistent layout I am looking for would be the same as if you did
the following on any page:
1) Select all
2) Copy
3) Paste to notepad
Is there a function or process that will retrieve all text and retain
formatting?
I have a text box if a user enters a phrase he enters it within single(') or double quotes(").
If the properties for test box are like this
<input name="test" id="test" value = "<%=queryText"%>"> then
the text box value is blank after submitting the form and when sourcecode is checked the value is ""testing"".
if modified to <input name="test" id="test" value = <%=queryText"%>>
then the value is shown after submitting the form as testing without quotes
The page is JSP search page.After submitting the page appears with all the results since it is a search page How can I retain the value as it is when the value is entered in quotes.
I'm using a plugin in Wordpress that checks for mobile browsers and sets a variable to "true" if a mobile browser is being used. I have a script I want to use on the same page where I'd like to use that variable rather than have to redo the check again. Is it possible to make a variable in one script global so that it can be used in a separate script on the same page? Greatly simplified, I mean ...
<script type="text/javascript">
var A = 1;
</script>
<script type="text/javascript">
Do something with A;
</script>
I'm loading external div content into another page div based on the hash. It works fine but when you click the link, the page loads, but it's blank. If you refresh the page it appears.I'm looking for some way to refresh the content (once).
View 1 Replies View RelatedI have a form within an iframe that I want to use to refresh the location of the parent. I am using the form to set session variables that are used within the parent. So in the iframe I have:
<form name="MyForm" method="POST"
action="<?php echo $_SERVER['PHP_SELF'] . '?' . SID; ?>">
And to submit this form I'm using this link:
<a href="javascript: submitform()">Search</a>
Which refers to this script:
<SCRIPT LANGUAGE="JavaScript">
<!--
function loadParent()
{
parent.location.href = "/search_results.php?";
}
function submitform()
{
document.MyForm.submit();
loadParent();
}
//-->
</SCRIPT>
(I think!) my problem is this; it works fine if the MyForm action, i.e. ="<?php echo $_SERVER['PHP_SELF'] . '?' . SID; ?>", completes before loadParent() is executed but if there is a slight delay in the time it takes for the server to do this, loadParent() is executed too early and the input from MyForm is lost.
What I need is to tell the script to wait until the MyForm action has completed, i.e. the page has refreshed, before running loadParent(). I'm sure there are loads of different ways of doing this. Ideally I would like something that detects the page refresh within the iframe (caused by the MyForm action) and not something that relies on a timed delay loop.
I've tried several solutions for this and have gotten close but right now I'm stumped.
Basically, I need to retain the existing scroll position on a page when it reloads but also to ignore any #anchors that are in the url.
Script to show on the web page that how many times user loaded it or refresh it. the counter restarted from 0 on closing the browser and open it again.
View 9 Replies View RelatedMy site's working perfectly in the other browsers, and when I delete line 28 (see below) it works in IE but not exactly how I want. Is there a way to retain two jquery references on a single page in IE?
This is the head section of my code:
I want program code only using html and javascript. First I took one form and created some data on it like
name:xyz
address:hyderabad
country:india.
hobbies:reading,cooking.
submit button.Above is one simple form after submit i want it to display it in another page like out.html.
how can i get data ( a div) from an html page and put it in a different html page in a certain place? i can't get it to work !! i need something else i think!! i need it to load when i click on a link or a text am i missing something?? i've put the code in a click function but it doesn,t work...
[Code]...
I stumbled across jQuery while during a search for my project that involves parsing and extracting content from HTML pages. I have a collection of xpath strings that identifies the data I would like to extract. Wondering if I could use jQuery for this purpose.
View 1 Replies View RelatedI am working on a simple tool for my office.We have a very huge database with 5000 tables. All the tables, Columns and their attributes are stored in to excel sheet.
Tool I am designing is for mapping between front end and back end values. Now I will use an image (front end screen of our application) , when user clicks it, I need the HTML to access the excel sheet and display the back end field,the name of tables it can be found in and other data related to that field
Simply,I want to pull data from excel and display them differently for each different click. I want to pass the parameter on click and filter a column in excel with it and display the entire set of sheet with this criteria. Is this possible? or am I expecting too much
Is it possible to group/ungroup data in a static HTML page, like you can in Excel?
I have a requirement to allow grouping/ungrouping of data like in Excel.
If it is not possible in a static HTML page, kindly suggest to me the best way to do it in order to get the same result in an HTML page
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
So here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.
View 1 Replies View RelatedI need to refresh multiple images on my site. So every time the page gets refreshed the images need to change. It worked fine with the script below, but this is only related to 1 image
I tried to copy the script and change the "ID's" but this does not do the job.
What should I change/add to the script below?
In head:
In body:
I need to have a simple text input field on a html page. It needs the users to type in either:
And depending on whats entered this will then take them to the corresponding:
Is this possible with javascript?
I am writing a small data entry screen that will post the form data to a page and return a message. But i cannot get the Success or Error functions working properly.
Here's the code where strData is the posted querystring of:
I'm not sure whether it should be in a form and using the onsubmit or click of a button.