JQuery :: Dynamically Load Data Driven Html Page?
Jun 30, 2010
So here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.
View 1 Replies
ADVERTISEMENT
Jun 25, 2010
I'm trying to dynamically insert the Tweetmeme button using Javascript. I'm currently using jQuery throughout the site. Here's the script that I'm using. I basically want to cycle through all the blog entries with a class of journal-entry and append the following JavaScript to the end. This Javascript comes straight from[URL].. This doesn't work for me though and it has something to do with the code between append(). It doesn't like the second set of script tags.
[Code]...
View 2 Replies
View Related
Feb 13, 2010
The code is supposed to generate this: PS: This is generated by a PHP Function that the Ajax Load Method Calls.
[Code]...
I've been noticing a lot of problems when loading these stuff, Sometimes I have to remake the HTML Tags because its not showing anything. Is there any option? I want it to load EXACTLY how it is, I don't know if this is some kind of protection for bad code, but if it is I would like to disable. But also, this code is really clean. no problem, I don't know.
View 1 Replies
View Related
Jul 27, 2009
I am trying to dynamically load html into a table, i.e add new rows in the table if a user clicks on an element in the table. Calling code :
<TD><a href="#" onClick="javascript:AddElement('someVal',
'someOtherval');return false;">Click ME</a></TD>
No problems there, I have a function :
function AddElement(someval, i) {
[Code].....
View 1 Replies
View Related
May 27, 2009
Here is the link to a page on my work web: -
[URL]
You will see that I have three combo box objects on this form - one containing dates (Date) and the other two containing times (Time1 & Time2). Each time on each date is an available appointment.
I would like the content of the date combos to be read from a file whenever the page is opened - a text file with one record per row would be fine (by way of an example - but this may be insufficient). On the face of it this would seem fairly rudimentary but I don't code in JavaScript of PHP and, having found this site I can make a start. I used to be a VB coder.
On each date the following appointment times are available: -
10:00
11:00
12:00
14:00
15:00
This assumes that no appointments on a given day are taken.This leads me to conclude that each date should have records for each time - possibly as a CSV text file as follows: -
"29th May 2009","10:00"
"29th May 2009","11:00"
"29th May 2009","12:00"
[code]...
The second time combo should make unavailable the time selected in the first time combo and present only those times available on the chosen date in the CSV file on the server.When I confirm appointments, at present I have to edit the page objects and update the web - which is quite messy and slow whereas uploading a simple text file, whilst an imperfect solution, is much better than what I currently have.
I believe that a PHP or Javascript routine based on events on the three objects would remove the inherent problems and would provide a useful set of building blocks for other routines of a similar nature.The routine would trigger whenever the page is loaded (or refreshed) or the content of any one of the three objects gets or loses the focus or a selection is made in an object.
The Date Combo would need to look up the available dates - keeping the currently selected date selected or, if that date is no longer available defaulting to the first date in the list. The user then makes a selection or makes no change to the selected date.The Time1 Combo then reads the available times for that date, retains the currently selected time (if available) or the first available time (if the selected is not available) and the user makes a selection or accepts the current selection.The Time2 Combo does the same as the Time1 Combo and in addition it eliminates the time selected in the Time1 Combo from the available choices.
The result is that visitors are only offered available times on available dates (insofar as this solution provides).When the form is submitted I would receive the email and confirm the appointment with the client and, in addition, I would modify and upload the modified data file to the web server using Filezilla. The benefit is that there is a slim to none chance of two people wanting to book the same times on the same date at exactly the same time (though it is possible). In addition, I can add new dates and add new times if there is a demand and I can even add previously deleted times if there is sufficient demand to warrant bringing in a second consultant to take the meetings.
View 1 Replies
View Related
Sep 11, 2010
I have a html file that I want to load, loop through the json data and for each json entry I want to add a new block of the html and insert the json data into the matching div/class of the html. json looks like this:
{"Super" : [{"Name" : "John Doe", "Age" : "30"}, {"Name" : "Jane Doe", "Age" : "40"}]};
html looks like this:
<div class="Name"></div><div class="Age"></div>
So for each json entry of name/age, I want to insert that into the html, and then add another row, until all json data has been fetched. After this I want to insert all of this into #box, which is just a divthat should contain that html. Looping like this obviously does not work, since I just keep replacing the same html through the loop.
var jsonData = {"Super" : [{"Name" : "John Doe", "Age" : "30"}, {"Name" : "Jane Doe", "Age" : "40"}]};
$.each(json.Super, function() {
$('#box .Name').html(this.Name);
$('#box .Age).html(this.Age);
});
View 3 Replies
View Related
Jul 18, 2011
I currently have a grid of thumnails which when clicked will load an image at the top of the page without reloading the page.This works wonderfully, However, what I need to do now is to produce the same thing but instead of loading an image, load an html file into the page without reloading.
View 5 Replies
View Related
Oct 17, 2010
Is it possible to use a .load or a .post or some other method to send a request to the server to update a page based on passed data and to return the updated html section and also to return an XML data structure back to the callback function in the .load method?I would assume at that point the load would load the #div section of the document to the target. If it is possible to send XML data also, how would I structure that and how would I send it and access it in jQuery or javascript?
What I want to do is update one section of the page with new html and then make some changes to another section using jQuery or javascript based on the XML data. Both changes are based on the data passed in the initial .load request so having to do it twice is redundant.
View 4 Replies
View Related
Jul 26, 2010
In the examples for live() and delegate(), the selectors match at least one element that already exists. Will either of these commands work on elements for which there is no match at all on page load?
In my case, I want to bind a keyup event to the textareas that jeditable creates. I could probably create custom plug-in (to the plug-in :) to do the job, but I'd like to use live or delegate if they would work.
View 2 Replies
View Related
Jan 26, 2010
I have created two onClick events that i need to combine into one with jQuery. I am not sure how to do this.I have an unordered list:
<ul id="coverTabs">
<li class="currentTab"><a href="#">Individual</a></li>
<li><a href="#">Couple</a></li>
[code].....
View 1 Replies
View Related
May 12, 2010
There is a project called Seed which allows JavaScript programs to run on the Linux desktop. There is connected project called SeedKit which runs HTML files as a Graphical User Interface front end for JavaScript files run by Seed. It acts like a webpage which rather than linked to a web-server is linked to a JavaScript program with HTML events like buton clicks etc that drives JavaScript much in the same way as normal desktop Graphical toolkits do. I hope this page from my blog starts a bit.
http:[url]....
Both projects are quite new so is very experimental. I am not involved in the development of any of the projects but I am trying to create a few examples to show how it works. My first example is to take the contents of the log folder /var/log, display it in the SeedKit HTML file and when a user clicks on it, it displays the contents of the log file.The way I am going about this is firstly to create a two column table in the HTML thus:
<!DOCTYPE html>
<html lang="en">
<head>[code]....
The table on the HTML file is populated with the file names but I can't get the contents of the specific div I have clicked on. I tried $(this).text() but it displays all the text in the table.
View 2 Replies
View Related
Feb 18, 2011
I have a section at the bottom of one of my pages that gets data that can be further filtered by weeks. Users can click on any of the weeks to see the data that applies only to that week. This works just fine, but when the function finishes and replaces the html content of the div, the page jumps to the top so that the user has to scroll back down to see the results. I'd like to avoid that. [code]...
It's nothing terribly complicated. The 'weekSelection' links are disabled until a stakeholder is chosen, then they're good to go. The weird bit at the url variable is just some ASP.NET MVC stuff.The StakeholderForecasting div gets its contents replaced and all will be good as soon as I can maintain the page's position.
View 5 Replies
View Related
Jul 27, 2011
how can i get data ( a div) from an html page and put it in a different html page in a certain place? i can't get it to work !! i need something else i think!! i need it to load when i click on a link or a text am i missing something?? i've put the code in a click function but it doesn,t work...
[Code]...
View 1 Replies
View Related
Jul 28, 2011
I know how to employ .load() to bring a partial doc.html into a receptacle division upon menu selection, but am still unclear after reading the api whether I can also load a dedicated .css file for it ...I suppose prior to content load(?)... or if I can/should outfit the doc.html with <head><style> yada yada</style></head> and load it as one doc..
Or is one obliged to write out the entire styling for the doc.html in camelCase as a string enclosed in .css() ??
These are various stories fetchable via a menu. Each one has a different and detailed set of classes for styling..
Lastly, should I identify each story as an id or class?
What I'm not wrapping my head around is how to lay out the stylesheet. If a particular story ...(I'm using the same name as its document page (minus '.html')... is denoted as a class or id, then how do I assure that all the classes and id's which are in effect subordinate only to that id or class name also get loaded...?
View 1 Replies
View Related
May 6, 2011
I'm trying to load content from an external page into a div on my page.
Can any one point me to a simple solution.
View 1 Replies
View Related
Nov 4, 2010
On my webpage, I dynamically create an iFrame when a button is pressed, then load a html page from within my own domain into the iframe, based on what html page is loaded into a variable. My question is, can I dynamically change the font family of the loaded html page from the javascript of the main page? My code to create the iframe is:
function setSubTxt(){
var par = document.getElementById('parentDiv');
par.innerHTML = '<iframe src="'+subTxt+'" style="width: 375px; position: fixed; height: 365px; left: 400px; top: 145px; border=none;" name="subIframe" frameBorder=0></iframe>';
frames['subIframe'].window.location=subTxt;
document.subIframe.document.body.style.fontFamily = "Arial";
[Code]....
the variable "subTxt" has the url of the html page to be loaded (always on the same domain). The code: document.subIframe.document.body.style.fontFamily = "Arial"; was my attempt to dynamically change the font, but it didn't work. Also, it should be noted that there is no font family set in the html pages which would override this.
View 6 Replies
View Related
Jul 11, 2011
I stumbled across jQuery while during a search for my project that involves parsing and extracting content from HTML pages. I have a collection of xpath strings that identifies the data I would like to extract. Wondering if I could use jQuery for this purpose.
View 1 Replies
View Related
Mar 20, 2011
I would like to use ajax to load a html page and get the content of a specific div. Is it possible to do this?
View 3 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Jul 23, 2005
I have two problems that I suspect will be bread-and-butter problems for the
more experienced guys on here, but I'm not the greatest with js.
NB: Code snippets at the bottom
The first problem is that after a bit of fiddling I'm getting am 'Object
Expected' error when I click on the Depot dropdown which I can't seem to get
round. The code I had was working OK but then I cut it all out, tidied it
all up, and put it back in and now it doesnt work.
The second problem is a 'How do I...'. I'm using an XML data island to
retrieve some data without submitting the form. In the first example, when
the user selects a Customer, the Depot list is updated with all the depots
for that customer; This all works fine. What I want to do now is retrieve
some more data when the Depot is selected.
I have the XML bits working; the js code snippet correctly output a series
of msgboxes with the correct value in (or at least it did until I introduced
the Object Expect error!).
However, I'm unsure as to how to display this information on the page. The
XML contains a series of Part No's and Quantities, which I'd like to display
in a table towards the bottom of the screen. The problem is that I don't
know how to dynamically create and populate this table.
The only caveat is that I dont want to show the table if no values are
returned from the query....
View 4 Replies
View Related
Jul 23, 2005
i need to add n number of text box in a html page, the main idea is
when the user press a button apear 2 text box and if he do it again
apear 2 text box more and so on, also need that all the text boxes has
a unique id, in order to make some thing whit the values. but i dont
know how to do it.
View 3 Replies
View Related
May 10, 2011
I'm trying to add html controls dynamically. and I successful in that using clone method. But I lost my way I confused how to retrieve the values from the controls which I had cloned. Below is the simplified code i had done.
[Code]...
View 1 Replies
View Related
Jun 29, 2009
I have an ajax based page, which loads content from external page (html +js) So if i have a div "update_div" being updated with external content (html+js)
Let me be more specifig
Step1: Ajax content along with js loaded into update_div from a.html
Step2: Ajax content along with js loaded into update_div from b.html
What happens to the js loaded from a.html? Is it lurking in the memory or automatically/magically removed from the browser memory? I am afraid of memory leaks, if the js is still lurking in memory, the more ajax calls made, the more js is going to be held up in memory. Unless am totally wrong; i have no idea of the mechanism happening.
View 11 Replies
View Related
Mar 14, 2009
I'm trying to add dynamically generated HTML after the page has loaded. I've tried two versions.The latest versions is this, using insertBefore (as appendChild is buggy in a few browsers according to the SitePoint reference) ...
Code:
addImageField: function(x) {
var newNode = createImageField(x);
var src = document.getElementById("imageUploads");
[code]...
The first alert returns: object HTMLFieldsetElement .The second alert returns: object HTMLDivElement....and the third alert fails to fire, indicating a problem with the code above.Note that if I change the problem line to remove the null reference it still doesn't work (again the third alert won't fire):
Code:
scr.parentNode.insertBefore(newNode,src);
View 4 Replies
View Related
Jul 1, 2010
I am trying to copy data from one element to another on page load.
I want to copy the below data within each element
To the different parts of this URL <a href=" [url]
View 12 Replies
View Related
Feb 15, 2012
I want to load data after loading related php page. i used ajax and even jquery.
jquery was not sure this is jquery code:
But this and when i was using ajax it changes data, but unfortunately, the pay now button (pay pal) was not working. curser changes but button don't work...
View 3 Replies
View Related
