I want to load data after loading related php page. i used ajax and even jquery.
jquery was not sure this is jquery code:
But this and when i was using ajax it changes data, but unfortunately, the pay now button (pay pal) was not working. curser changes but button don't work...
My goal is to load the JS for a specific element before displaying that element. I integrated a third part script, and it works well. I set the timer here:
The JS is in my heading as <script type="text/javascript" src="countdownpro.js"></script>
About mid-body I have: <span id="countdown1">2010-07-20 00:00:00 GMT+00:00</span> which allows for the setting of a target date to countdown to.
When the page first loads it shows the above long format target time, until the js/meta tags kick in to modify it to just show the actual countdown as 00:00:00.
I have attached countdownpro.js to this post. I tried shifting the function CD_Init() to the top of the script, and also appended it inline with the .html. I tried setting the big external script to "defer", but neither arrangement worked. I also tried placing the src file right at the top.
i have this code
$.ajax({
type: "POST",
url: "<?=base_url()?>users/register",
data: $("#register_form").serialize(),
success: function(html){
[code]...
So I have an order form which gets all validated with fields, checkboxes, radiobuttons and so on...after submiting I would like to show pictures related to what was order/picked...as of right now when I click sumbit it just shows no "error message/validation errors" since the information is just correctly entered but I would now like to go to another page? clear current page and basically show images...say my radiobuttons was car selection with options bmw, audi, lexus ect...now after submiting a new page loads ontop? showing a picture of the brand selected? how would I go abouts doing this?
View 2 Replies View Relatedonclick="window.open('Open.jsp', null,'scrollbars=yes,width='+(screen.width - 100) +',height='+(screen.height - 100))"/>
i have that . but before page loads, i want to show a loading image..then on page load i will hide it.. second part is easy.. window.onload i hide it..but i have problem first part.. showing the image before page opens...how can i do it?
I'm trying to load a div from one page into a div on my page.
$('.trigger').click(function(){
$('.ajax').hide();
$('#content').load('test.html #test');
});
[Code]....
The prob is when the trigger is click, the whole page is replaced with the 'test.html' page, while I would like just the '#test' div from the second page to be loaded into the '#content' div on the start page.
Oh, jQuery 1.6.1
[URL]
I have an image gallery here on the top left. It works by the user clicking a thumbnail and displaying the larger thumbnail above it. Currently, all of the images are preloaded, including the large image above the thumbnails which takes up unnecessary loading time.
How can I make it so for example, AFTER the user clicks on a thumbnail, THEN the bigger thumbnail loads. NOT BEFORE the whole page loads.
Here's my javascript code: [URL]
is there a way to after thye page load add an image. So maby loading it in the background and just showing it when you click a button?
View 7 Replies View RelatedI am loading Default2.aspx from MainPage.aspx. i need to display the condense of Default2.aspx in the Div(maincontent) which i declared in Default2.aspx.
with the below code iam getting the DIV object of Default2.aspx from MainPage.aspx.
but the Default2.aspx is not showing ,can any one correct the below code. code...
Is it possible to "Only" display a loading message and hide all page's elements and graphics until the page is fully loaded. then loading message disappear and the content fades in!?[code]...
View 4 Replies View RelatedI created a bookmarklet script to help me audit extremely large style sheets.Basically while on a site that you would like to audit, you click the bookmarklet and the document's body contents gets remove and replaced with an iframe that points to the current sites home page. From here you can choose what style sheet (the script finds) to begin reporting over. The more pages you browse (through the iframe) the more accurate the report gets.My problem however, is if the person is on the site's home page when first running the script, the iframe never loads up. I think it has to do with the fact that you are on the home page, and then the iframe tries to point to the home page as well and fails for some reason.You can test it by bookmarking this bookmarklet and running it on any site's home page where style sheets can be found:
Get The Bookmarklet on this page (http://tinyurl.com/3gx7fw5)
Again, it works great if you don't start the script from a sites home page.
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
I've gotten .load to load content into a div but if the window is not at the top of the page it scrolls back to the top each time the new content is loaded but I wanted to avoid any sort of change on the page other than the content in the div. It seems pointless if the user has to scroll back down to the div where the content is each time? code...
Is there a way to keep the window in the same position? Also while I'm at it - is there a more efficient way to write this considering I have 9 pages or should I just write this code out for each instance?
Is it possible to use a .load or a .post or some other method to send a request to the server to update a page based on passed data and to return the updated html section and also to return an XML data structure back to the callback function in the .load method?I would assume at that point the load would load the #div section of the document to the target. If it is possible to send XML data also, how would I structure that and how would I send it and access it in jQuery or javascript?
What I want to do is update one section of the page with new html and then make some changes to another section using jQuery or javascript based on the XML data. Both changes are based on the data passed in the initial .load request so having to do it twice is redundant.
I am trying to copy data from one element to another on page load.
I want to copy the below data within each element
To the different parts of this URL <a href=" [url]
I have a page with a lot of data validation on it (for a form). But the validation is not actually executed until the user hits Submit. The page loads really slow. Is there a way to control how a page loads so that, as I suspect, the validation Javascript loads after the form actually displays? I want the user to see the page/form displayed as quickly as possible while I recognize that the the page load may not be complete because its still loading the validation routines. What I can do to speed it up?
View 3 Replies View RelatedSo here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.
View 1 Replies View RelatedI have a section at the bottom of one of my pages that gets data that can be further filtered by weeks. Users can click on any of the weeks to see the data that applies only to that week. This works just fine, but when the function finishes and replaces the html content of the div, the page jumps to the top so that the user has to scroll back down to see the results. I'd like to avoid that. [code]...
It's nothing terribly complicated. The 'weekSelection' links are disabled until a stakeholder is chosen, then they're good to go. The weird bit at the url variable is just some ASP.NET MVC stuff.The StakeholderForecasting div gets its contents replaced and all will be good as soon as I can maintain the page's position.
i know my summary is not the clearest so here goes....
the page www.philip
-----
dusel
.com
has several links to click ...all different images. they all link to the same page which is an image gallery. i would like for the new page to open with the related image enlarged in the gallery instead of always showing the first image in the list regardless of which link was clicked. i hope i am being clear.
ps what is the standard way of providing a link yet hiding it from the crawling robots?
It's the Coda Slider script on here: [url]
If you scroll to the bottom, and click: "See what our users have to say" and you can see the sliders.
It's working in all browsers but Safari, the script just doesn't seem to be loading, I get the loading scroller bars but they don't fully load. What is the best way to debug JS - is that the right term?
I'm running into a little bit of a problem with tinyMCE. My textarea is not loaded with the initial first page load but dynamically inserted in the DOM via ajax, so it doesn't display.
I've studied the documentation that comes with tinyMCE and it still kinda puzzles me what I have to do to "dynamically load" tinyMCE.
The code is supposed to generate this: PS: This is generated by a PHP Function that the Ajax Load Method Calls.
[Code]...
I've been noticing a lot of problems when loading these stuff, Sometimes I have to remake the HTML Tags because its not showing anything. Is there any option? I want it to load EXACTLY how it is, I don't know if this is some kind of protection for bad code, but if it is I would like to disable. But also, this code is really clean. no problem, I don't know.
I have a single webpage that contains information on all 50 U.S. states. There are 50 links at the top to jump down to the state you want, and at the bottom of the information for each state a Back to Top link.
I'm making the Back to Top link into something more complex, and it will require three or four lines of code.
So that I don't have to repeat the code 50 times, and create a burden when I need to edit it, I want to place it in a .js file and call it x. Then below the information for each state I'll simply have:
Does calling code from a .js file 50 times slow down the page load? Which method would load faster?
I am using jquery and i add the input boxes but when i try to get data from them i can't any ideas
Code:
$("#addmore").click(function(){
m=m+1;
[code]....
I have a site that is very jQuery and image heavy. The main sections of the site link to sections that are built with several Tabs, and as it loads, you briefly see all the content load and then it is hidden by the Tabs code.
The plan is to have a full window DIV that sits above all the content with a loading icon that plays until the entire page loads, and then it fades down.
After some hair pulling and research I have code in place that does exactly as I ask, however it does not seem to work in IE6+7. It works in all other browsers.
The current code is:
CSS for the loading DIV is:
A working link is [url]
I have a lot of javascript functions that request information from an iframe hidden on the page. I see other sites do this, but their browser does not do the loading action (like the processing circle in Firefox). When I do it on my site, each browser shows the loading icon, as if a page was loading. Is it possible to not have this?
http://bit.ly/cv1YqN
That is a sample link. Go down right side of page where you see three buttons: Trailers Featurettes Clips.Those return iframe information to work.