JQuery :: Loading Array Data Into A Jqgrid?
Jan 12, 2011
i had created a test page for showing a grid for a task demo. I am supposed to fill it with dummy data for now.i have been using jqgrid for quite some time and many of the pages are working on some live projects also,but today i was unable to populate the data from an array.i have created a test script for you people to see, here also i am facing the same problem, i dont remember what all was required to fill it as it has been quite some months since i worked on jquery.this is the link for the test page
View 2 Replies
ADVERTISEMENT
Jul 14, 2010
I am loading the array data into jqgrid ,but it is giving some errors . point out the mistake in the code.
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<title>jqGrid Demos</title>
<script src="js/jquery.jqGrid.js" type="text/javascript"></script>
[Code].....
View 1 Replies
View Related
Jul 22, 2010
I have a JQGRID table and when I click submit I wanna post entire grid data to server.
View 2 Replies
View Related
Dec 16, 2011
A program I am writing will be loading the data of a file into an array. This data is read as an image and is displayed. Part of it will be the modification of palettes, so if I click Palette 4, it would go in and edit the array to have new contents (predefined by me) and redisplay the image in place of the one that was there before. How would I load a file into an array and display it as an image and stuff?
View 11 Replies
View Related
Aug 5, 2010
I need to use jqgrid with spring mvc3.0.get any help regarding the same?
View 1 Replies
View Related
Apr 16, 2011
Whether i am able to show a progress bar in jqgrid (the values are whatever).
View 1 Replies
View Related
Jun 9, 2011
How do I display specific records only in jqGrid? For example a user login then the jqGrid should display records that is related to the user logged-in only.
View 1 Replies
View Related
Jul 2, 2009
how to let the jqgrid refresh? without page reloading. does jqgrid have such a method? how to call it?
View 1 Replies
View Related
Jul 16, 2009
I am needing an accordion with dynamic data loading on each tier.
View 1 Replies
View Related
Aug 11, 2010
Apologies if this is a fairly simple question! I'm fetching data (from a MySQL database), and would like to show an animated loading image while the data is being downloaded, and obviously then hide it when the data is fully downloaded. I've found plenty of tutorials describing how to achieve this is the other direction (i.e. when submitting a form) but I'm not sure how to adapt these to what I want.
View 2 Replies
View Related
Apr 15, 2009
I am not able to use jqGrid and jquery lightbox plugin in a single page. Its shows an error i.e. Lightbox was not able to find it's javascript script tag necessary for auto-inclusion. What does it mean ?
View 1 Replies
View Related
Jul 20, 2010
I want to read the value where my click event happened in my jqgrid for storing it in my database. I tried this to check if I got the value of my click event:
$('#sourcegrid').click(function(){
alert($(this).val);
});
View 1 Replies
View Related
Nov 19, 2011
I want to have a simple code such that some data is stored in array. When we create a search box it has to give suggestions from the data stored in array.
View 4 Replies
View Related
Mar 26, 2010
I'm trying to grab values from a set of arrays based on the value returned by my select box.
**Caveat - this is not an area I have any real experience with**
My arrays look like:
Code JavaScript:
I then need to test for each, then associate with one of my fees arrays, then grab each of the values in the array and write those values to elements within my page.
I'm then doing this to evaluate for each degree
Code JavaScript:
I need to first figure out how best to import all of these 60+ arrays and then in each of my conditions pull out each value and write to my page.
There is a unique 1 to 1 relationship between each degree and array so I can't consolidate as the values for each degree differ slightly.
View 3 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Sep 4, 2010
I'm not sure how to make something draggable which is dynamically loaded. The click event works fine on the new content though.
Like for example [code]...
View 4 Replies
View Related
May 22, 2009
We are using jQuery JavaScript Library v1.3.1 for paging and sorting purposes. This library is working fine when we are loading smaller
data sets (<1000 records) on the page. However, when data set starts getting large (>3000 records), the initial page gives a script loading
error and the page does not load at all.
View 1 Replies
View Related
Apr 11, 2011
I am using jquery autocomplete combobox I load more than 25000 data. I set
minLength:3, delay: 700,
When I start typing three characters, in the third character ie8 shows the "Stop running this script" how to handle this huge amount of data
View 1 Replies
View Related
Oct 1, 2009
I am having a little problem trying to show a loader (An animated GIF) while some request to a database happens. I have a page where the user selects a YEAR and when they select it with AJAX I perform a request to a database to get all the values for that specific year.
The problem is that there is a lot of information (4000+ records) that I need to query and show in a table (Actually I didn't use a table I use DIVs that look like a table), and when the user selects the year the webpage freezes for about 5 seconds and then it loads all of the data.
Is there a way to sort of show an image loader gif while the data is being gotten? I tried putting the loader image in the DIV container while no year is selected and then once the request is done, I substitute the DIV container's contents (The image loader) for the data from the database.
[Code]...
View 1 Replies
View Related
Aug 14, 2011
Is Json considered the better file format for loadind data via Jquery AJAX? I am going to use it either way, but from a cutting edge stand point, is JSON looked at a more cutting edge since it loads faster. 2. And for that matter is anyone using css3 and E4X? All these seem to require the latest versions of all browsers. Since my goal is to be cutting edge I was thinking to do some stuff in the above listed that require only the latest browser if it is detected, if not use what works in most all browsers? What are cutting edge web app developers really doing at this time?
View 2 Replies
View Related
Nov 12, 2010
I'm hoping this is possible or that there is an easier way to do this. I'm having an issue with displaying data from one array that contains information about users in a table that is controlled by a different array.Is it possible to do this or is this use of arrays to display the data the wrong approach?
The table is located on one webpage, I simply want to extract one piece of information that I have placed in the initial array as part of the login script that contains user information (for validation for login etc) and display it in a table on the new webpage that is opened as a result of successful validation of the user details. I'm completely stumped and after many attempts I just can't seem to get it to work.
View 2 Replies
View Related
Aug 14, 2010
Normal way to access data such as arraydata.INPUTID.field1 is no problem.My problem arises when trying to access data when iterating over input fields in a form. THISID is of course the id of the actual input which corresponds to the INPUTID of the data. Can't find a solution, what should stand instead of THISID in the iteration?
View 2 Replies
View Related
May 11, 2011
The script below works, but only returns one headline/url from the html list.I am coming from a procedural background and know there must be a better way to pass all the urls and headlines (the link text) to my PHP script, which populates my database, but even after reading 'Jquery in Action' I am flummoxed.how to attack this problem? The .each portion of my script does not seem to work as I expect it to. I have also tried append, which would seem to be a solution ... really all I need is the "which" value from the url, so passing a simple array of those values to PHP would suffice.
<SCRIPT>
$("#latest-news button").click(function () {
$.each(function()[code]....
View 5 Replies
View Related
Mar 30, 2011
I have been tearing my hair out with this for the past 12 or so hours and am no closer to a solution than when I began.
I have a jquery function to dynamically create <li> tags for an unordered list:
$(function() {
var idealist = $('#idealist');
$('.checklist').click(function(event){
item = '';
[Code].....
This is working fine. The problem is I need to somehow pull the ids from each <li> tag into a string or an array that can be made available somehow to php code for further processing. I can create the string or array within my jquery function but can't figure out how to make that available to php.
View 10 Replies
View Related
May 12, 2011
I am using JqGrid [URL] to display data in my application. In jqGrid I found a problem with IPAddress. If anyone of the column in JqGrid have IPAddress value, then sorting functionality in the jqGrid is not working properly.
View 3 Replies
View Related
Oct 25, 2005
I've got a script that I'm using to render a list of links. The data comes from an xml file.
If I run the code in IE, I get all the data formatted the way I want it to.
If I run the code in Firefox, I get squat.
I suspect the problem lies in "xmlDoc.getElementsByTagName".
I'm using it to collect elements for rendering.
Any suggestions? Code:
View 4 Replies
View Related
