Loading Firefox With Xml Data
Oct 25, 2005
I've got a script that I'm using to render a list of links. The data comes from an xml file.
If I run the code in IE, I get all the data formatted the way I want it to.
If I run the code in Firefox, I get squat.
I suspect the problem lies in "xmlDoc.getElementsByTagName".
I'm using it to collect elements for rendering.
Any suggestions? Code:
View 4 Replies
ADVERTISEMENT
Oct 25, 2007
I am seeking a easy to maintain and more importantly *working* way to
pre-fetch images, so the pages I develop load smoothly without seeing
the images kick in flicker as they usually do. Important - I need
this to work on Internet Explorer 6.0+ and FireFox.
I am presently using at the head of the page,
pic100= new Image;
pic100.src="./imageme.gif";
However, it doesn't seem to work on FireFox at all. I've tried
different combinations with the URL path, but I don't know what I am
doing wrong. Can someone please assist me with this boggle?
View 23 Replies
View Related
May 1, 2009
I'm building a home page with an update checker. A function, called 500 millisecs after the page loads, appends an external .js file and compares a variable on it to a different internal variable. If the internal variable is lower than the external variable, then the update prompt is displayed.
This all works fine, but the status bar says "Read www.primedesigning.com" (the site with the external js), or sometimes "Transferring from www.primedesigning.com". But, if I hover over any link, the status bar goes back to "Done". Also, if I leave my mouse still, wait for the update prompt to appear, and then move the mouse, the status bar says "Done".
I have the Fasterfox extension installed, and it confirms what the status bar is saying. It never stops loading unless I do 1 of the 2 solutions mentioned above.code...
View 4 Replies
View Related
May 15, 2010
I'm actually doing a firefox extension in which i would like to implement the jWebsocket API in order to build a small chat. I got my main script file, named test.js, and the jWebsocket lib into a js folder. Just for you to know, this is my first firefox extension ever. So in my XUL file I got this :
[Code]....
View 1 Replies
View Related
Sep 6, 2010
I'm using pager functionality to navigate a slideshow with thumbnails and next and previous images. In Firefox 3.6.8 on OSX 6.4 the main image displays at 6px wide and 18px high if I clear the cache and load the page fresh. Once the images are cached, subsequent page loads show the images at their correct size. I'm stumped.A secondary issue I'm having is that I'm displaying both vertical and horizontal images and would like to center them within their container, but haven't figured out how to apply the pager functionality once I wrap the images in a div to position them.Here's the site in development, and I've attached a screenshot of the sizing discrepancy (since it seems to be very specific to Firefox on OSX - Safari does not display the same issue)Attachments Screen shot 2010-09-06 at 2.53.10 AM.pngSize : 353.76 Download : 344
View 2 Replies
View Related
Jan 4, 2012
My code is very simple: a div conatining 5 images (always the same 5!) to swap using the fade effect. It works fine in IE but in Firefox (I have Firefox 8.0) the images are not being uploaded. I checked previous posts and some point out that instead of doing
[Code]...
I would need to include a 'load' event trigger. However, since I am not that familiar with javascript or jquery programming, I couldn't manage to program this solution and tested.
View 4 Replies
View Related
Aug 18, 2009
I don't know if it's a bug in jquery but some of you can have encounter the same problem with their
With the last version of Firefox ( 3.5.2 ), the site is render twice during the loading.
We can't isolate which element can produce this problem and it happens only with the firefox 3.5 ( not in 3.7pre or 3.0.12, not in ie, etc...
We load some js from external source ( facebook, googlesyndication, etc...
View 1 Replies
View Related
Nov 6, 2009
I am experiencing a problem with some images I am using for navigation. In Safari on my Mac everything displays as it should. The image loads ok, I mouse over the image and it goes black and white, mouse out and it goes back to colour.
When I tested this with Firefox and Opera on my Mac and IE8 and Firefox on my Windows laptop the onmouseover image does not appear and I am left with a text link and a lot of flickering as you move the mouse about.
I have almost zero knowledge when it comes to javascript and I've got the necessary code which according to everyone works from either books or the web.
I am completely stuck as to why this simple operation is not working.
you can see the page at this address: [url]
Only the left hand image has been set to onmouseover as I was testing to see if it worked first.
I have attached the CSS and HTM files in a zip file.
View 6 Replies
View Related
Jul 22, 2004
I have an XML page I'm trying to load with javascript to display on Mozilla Firefox. I can get this to work on Internet Explorer but it would not work on Firefox. I can't figure out what I'm doing wrong. Can someone glance at my short piece of code below and tell me why this wouldn't work on firefox? Code:
View 2 Replies
View Related
Oct 14, 2007
I'm working with a pretty large XML file, but I really only need to
display a few things that requires quite a few transforms. I already
limited to the transforms to the data i need to use, but I'd like to
speed things up by loading only the data I need.
I need to mention that this is for a local application that sometimes
will lookup updates on a server, but mostly, it is for local use
(offline)
I can use xmlHTTPrequest for both local or server data access. That
seems to work fine. Now I would like to be able to load only the data
I need.
I hear the Google suggest tool bar uses xmlHTTPrequest to look up a
list of known queries, so I am hoping they lookup "only" the necessary
data as one types. It's kinda what I want to do, but I'm not sure how
that would work, since the "url" parameter should be a destination
file name.
View 2 Replies
View Related
Nov 20, 2006
im trying to get values from a database and assign them to icons which display on my page. The icons that are generated on the page are generated in javascript- and they do work. Howver i want icons to hold the names that are in the database/table.
how would i do this? would this be using a query result in asp to get the values from the database?? how would i do this? please provide code or guide.
then, how would i assign the database value with the icons???? ive heard javascript arrays??? how would i assign the values??
View 1 Replies
View Related
Dec 16, 2011
A program I am writing will be loading the data of a file into an array. This data is read as an image and is displayed. Part of it will be the modification of palettes, so if I click Palette 4, it would go in and edit the array to have new contents (predefined by me) and redisplay the image in place of the one that was there before. How would I load a file into an array and display it as an image and stuff?
View 11 Replies
View Related
Mar 21, 2011
I have a jQuery based gallery [URL] that will load thumbnails to the bottom of a page, however for some reason these images only load on Firefox and IE (Not Chrome or Safari). I'm not sure this is due to jQuery completely.
View 3 Replies
View Related
Jan 28, 2011
I built jQuery UI tabs with jQuery UI Accordion embedded into each tab. It works fine on my local machine, it also works fine on all browsers in the development server except using Mozilla Firefox.
[Code]...
View 2 Replies
View Related
Oct 1, 2009
I am trying to write code to print a message 5 seconds after document has loaded.
<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd">
<html>
<head>
<script>
[Code]....
The message appears ok but the page loading bar in the browser + hourglass wont go away (in firefox).
View 1 Replies
View Related
Oct 30, 2005
I've written a slideshow script which loads and displays a series of >1Mb images from the local machine. Each image is loaded twice - once to get the dimensions and once to be shown on the screen, so it can be dynamically resized by another script.
This script runs without problems in Opera and Internet Explorer, no matter how many times it's executed. However, after it runs a couple dozen times in Firefox, the width and height attributes of the image start returning 0. It seems like the loading has slowed down considerably and the script starts skipping to the next line without waiting for it to finish.
I've tried adding the line while(!image.complete), which works, but invariably causes Firefox to display a message saying the script is causing Firefox to run slowly, and asking if I want to abort.
Is there a way I can flush earlier images from the cache, or somehow free up resources so the script will continue to run as quickly as it does at the start?
View 1 Replies
View Related
Jul 16, 2009
I am needing an accordion with dynamic data loading on each tier.
View 1 Replies
View Related
Aug 11, 2010
Apologies if this is a fairly simple question! I'm fetching data (from a MySQL database), and would like to show an animated loading image while the data is being downloaded, and obviously then hide it when the data is fully downloaded. I've found plenty of tutorials describing how to achieve this is the other direction (i.e. when submitting a form) but I'm not sure how to adapt these to what I want.
View 2 Replies
View Related
Jan 12, 2011
i had created a test page for showing a grid for a task demo. I am supposed to fill it with dummy data for now.i have been using jqgrid for quite some time and many of the pages are working on some live projects also,but today i was unable to populate the data from an array.i have created a test script for you people to see, here also i am facing the same problem, i dont remember what all was required to fill it as it has been quite some months since i worked on jquery.this is the link for the test page
View 2 Replies
View Related
Jun 17, 2011
I am working on some sort of a program that will load data from a notepad or Excel file and load it into a ComboBox. The notepad file would have names and phone numbers in it. The ComboBox would only show their names in alphabetical order. There would also be a button that when you click it, it would open up Outlook (if you are signed into Outlook) and auto-fill the form with their phone number @ vtext.net (for texting verizon cell phones). The reason behind this is so the notepad or Excel file can be edited to add more users as the company expands.
how to do the data on load.
View 5 Replies
View Related
Jun 9, 2004
how to load an XML file into a DOM. I can get it done in IE, but in mozilla I am missing something. Here is what my loadXML() function looks like:
function loadXML(){
try {
xmlDoc = new ActiveXObject("Microsoft.XMLDOM");
xmlDoc.async = "false";
xmlDoc.onreadystatechange = verify;
hasFile = xmlDoc.load(info.XMLDocument);
if (hasFile){
xmlObj = xmlDoc.documentElement;
allTopics = xmlObj.getElementsByTagName("topic");
}}
catch(e) {
xmlDoc = (new DOMParser()).parseFromString(document.getElementById('info').innerHTML, 'text/xml');
hasFile = true;
allTopics = xmlDoc.getElementsByTagName("topic");
if (hasFile){
allTopics = xmlDoc.getElementsByTagName("topic");
alert(allTopics[0].firstChild.getAttribute("name"));
}}}
Where verify is another function. The try part works for IE, but the catch part doesn't work for Mozilla. I am not finding any information as to really use an XML DOM properly in Mozilla. I'm trying to get allTopics to be a handle on the same thing in both the "try" and the "catch".
View 8 Replies
View Related
Feb 15, 2012
I want to load data after loading related php page. i used ajax and even jquery.
jquery was not sure this is jquery code:
But this and when i was using ajax it changes data, but unfortunately, the pay now button (pay pal) was not working. curser changes but button don't work...
View 3 Replies
View Related
Apr 28, 2011
Here's what I'd like to do using pure JavaScript and HTML (no Ajax or PHP): My website loads different JavaScript files dynamically which contain a bunch of data, that I will display on the website. The dynamical loading function is placed in the <HEAD> and looks like that:
Code:
function loadJsFile(filename){
console.log("loading js file")
var fileref=document.createElement('script')
fileref.setAttribute("type","text/javascript")
fileref.setAttribute("src", filename)
fileref.onload = dataIsLoaded;
if (typeof fileref!="undefined"){
document.getElementsByTagName("head")[0].appendChild(fileref)
}}
The dataIsLoaded method in there is a callback that is triggered when the JavaScript file has been loaded:
Code:
function dataIsLoaded(){
console.log("loading js file done")
dataLoaded = true;
data = new Data();
}
DataLoaded is simply a global boolean that is per default false and the 'data' variable contains all the data I want to display on my site. While the JavaScript file is being loaded, the browser continues building the site. When it gets to the <body> that wants to access some information from the data variable, I get the unsurprising error that 'data' is undefined. I looked for a way to wait until 'data' is defined and then continue with building the <body> but couldn't find a solution.
Alternatively I wanted to reload the divs in the <body> when the 'data' is available:
Code:
function reloadDivs(){
if(dataLoaded){
console.log("data available, reloading divs");
document.getElementById('someDiv').innerHTML = document.getElementById('someDiv').innerHTML
}else{
console.log("data is not yet available");
setTimeout('loadReportData();', 500);
}}
This does not work, I get a blank div when I do that.
View 10 Replies
View Related
May 6, 2007
I wrote an "ajax" script that pulls dynamic content into a div container via xmlhttp. There is a variety of lists on this page that are all ajax. Basically the up/down arrows in the Music, Photos, Users, Community etc boxes have this javascript funtion that replaces the innerHtml properties of a div to some response data from an asp.net object.
In IE these up/down arrows works fine and pull in data, but in FireFox the divs come up with "Undefined" in the div instead of the data.. Code:
View 3 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Sep 4, 2010
I'm not sure how to make something draggable which is dynamically loaded. The click event works fine on the new content though.
Like for example [code]...
View 4 Replies
View Related