Loading Partial Data With XmlHTTPRequest ?
Oct 14, 2007
I'm working with a pretty large XML file, but I really only need to
display a few things that requires quite a few transforms. I already
limited to the transforms to the data i need to use, but I'd like to
speed things up by loading only the data I need.
I need to mention that this is for a local application that sometimes
will lookup updates on a server, but mostly, it is for local use
(offline)
I can use xmlHTTPrequest for both local or server data access. That
seems to work fine. Now I would like to be able to load only the data
I need.
I hear the Google suggest tool bar uses xmlHTTPrequest to look up a
list of known queries, so I am hoping they lookup "only" the necessary
data as one types. It's kinda what I want to do, but I'm not sure how
that would work, since the "url" parameter should be a destination
file name.
View 2 Replies
ADVERTISEMENT
Apr 1, 2010
I can use the jQuery ajax function to grab all of the html from a remote page, and that's cool. What I would like to do is to grab only a particular element of the remote page, not the entire page. Is this possible? I've tried some variations of the ajax 'url' param, but I haven't gotten anything to work yet.
View 3 Replies
View Related
Dec 4, 2009
I'm a newbie trying to modify the code in an AJAX tutorial to load data from an XML file, and it is not working. The code is in a php file that is invoked with the URL:getXMLTest.php?showName=photoShowTest.xml The code I've written (mostly copied from the tutorial, actually) is:
<!Doctype HTML>
<html>
<head>
[code]....
View 8 Replies
View Related
Jul 23, 2005
I am playing with the XMLHTTPRequest method to perform client/server
transactions. I have it set up right now so that when readyState is 4,
it takes the XML and processes it. This works great until there is alot
of data. In that case, the user will have to wait for the data to come
back which may take a minute or so.
I don't want the user to have to wait. Is it possible for javascript to
periodically (while still receiving more data) stop and display what it
has received thus far? I guess this would be considered a type of
streaming.
In mozilla/firefox, I have read that I can use readyState 3 to run my
callback function every 4096 bytes. I can then take those 4K, parse
them, and then continue on. However I have also read that IE cannot do
this. Since I need this to work in IE, is there a workaround?
View 22 Replies
View Related
Jul 23, 2005
My JavaScript is trying to POST data to a CGI script (Perl) using
XMLHttpRequest. My CGI server gets different data from IE than Mozilla
Firefox.
// For Mozilla, req = new XMLHttpRequest();
// For IE req = new ActiveXObject("Microsoft.XMLHTTP");
req.onreadystatechange = requestHandler ; // function to handle async
response
req.open('POST', myURL, true); // use POST
req.send('foo=11&bar=22') ;
A Perl CGI script prints the parameters passed to it.
$q = new CGI ;
foreach my $param ($q->param) {
print "$param: " . $q->param($param) . "
" ;
}
The data received by the CGI script is inconsistent, depending if the client
is IE or Mozilla (Firefox)
Server result from IE client:
foo: 11
bar: 22
Server result from Mozilla Firefox client:
POSTDATA: foo=11&bar=22
It seems that the POST data IE sends is more correct than the Mozilla data.
Is there another way to send the data in Mozilla so the CGI script will give
the same results. I could easily adjust the CGI script, but I think the
problem is at the client.
View 5 Replies
View Related
May 9, 2010
I am having trouble populating elements from the following Yahoo RSS feed: [URL] I need to show the current weather conditions when a button is clicked. Here is what I have so far.
[Code].....
I need to populate the <h1> and two <p> elements. I know that the copyWeatherData() and getWeatherData() functions are not coded properly.
View 2 Replies
View Related
Sep 18, 2008
I'm reading the content of a local binary file with the method mentioned here: [URL]
Then I'm getting the data as a string where each character represents the binary value. I have successfully sent that string with Mozilla's XmlHttpRequest's sendAsBinary method, but IE 7's version doesn't have that method...
Using the send method almost works, the only problem is that binary content can be represented as the asciicode 0. This means that the string read by sent is cut off as soon as it is encountered. That means that the part before the first NULL character (asciicode = 0) is successfully sent to the server.
The solution I have made right now is to increment each character's asciicode on the client side by one and decrement them on the server before converting the character to the binary representation. The downside with this is that the size of the data sent between the client and server gets larger than the original filesize. Ex: 8kb file grows to ~12kb.
View 1 Replies
View Related
Apr 3, 2006
I am going to use the server push
for streaming the data by keeping the connection open. At client side,
i am having the XMhttprequest object (i.e ActiveX object of IE). When
the data comes, onreadystatechange method get callback on state 3 but
it doesn't allow me to read the data from the object. It says 'The data
necessary to complete this operation is not yet available'. Is it
possible to read the streaming data from the XMLHttprequest object in
IE?
I know Mozilla supports to read the data, when the ready state is 3. In
Internet Explorer, how we can use the XMLhttp Active object to read the
streaming data.
View 3 Replies
View Related
Mar 20, 2009
I am trying to read data from server using AJAX XMLHttpRequest.responseText.In received data, there are lot of similar type of characters which has tge value of FFFFFD (65533). I think, all characters which has the value above 127 are converted to default character.
View 1 Replies
View Related
Oct 25, 2005
I've got a script that I'm using to render a list of links. The data comes from an xml file.
If I run the code in IE, I get all the data formatted the way I want it to.
If I run the code in Firefox, I get squat.
I suspect the problem lies in "xmlDoc.getElementsByTagName".
I'm using it to collect elements for rendering.
Any suggestions? Code:
View 4 Replies
View Related
Nov 20, 2006
im trying to get values from a database and assign them to icons which display on my page. The icons that are generated on the page are generated in javascript- and they do work. Howver i want icons to hold the names that are in the database/table.
how would i do this? would this be using a query result in asp to get the values from the database?? how would i do this? please provide code or guide.
then, how would i assign the database value with the icons???? ive heard javascript arrays??? how would i assign the values??
View 1 Replies
View Related
Dec 16, 2011
A program I am writing will be loading the data of a file into an array. This data is read as an image and is displayed. Part of it will be the modification of palettes, so if I click Palette 4, it would go in and edit the array to have new contents (predefined by me) and redisplay the image in place of the one that was there before. How would I load a file into an array and display it as an image and stuff?
View 11 Replies
View Related
Jul 16, 2009
I am needing an accordion with dynamic data loading on each tier.
View 1 Replies
View Related
Aug 11, 2010
Apologies if this is a fairly simple question! I'm fetching data (from a MySQL database), and would like to show an animated loading image while the data is being downloaded, and obviously then hide it when the data is fully downloaded. I've found plenty of tutorials describing how to achieve this is the other direction (i.e. when submitting a form) but I'm not sure how to adapt these to what I want.
View 2 Replies
View Related
Jan 12, 2011
i had created a test page for showing a grid for a task demo. I am supposed to fill it with dummy data for now.i have been using jqgrid for quite some time and many of the pages are working on some live projects also,but today i was unable to populate the data from an array.i have created a test script for you people to see, here also i am facing the same problem, i dont remember what all was required to fill it as it has been quite some months since i worked on jquery.this is the link for the test page
View 2 Replies
View Related
Jun 17, 2011
I am working on some sort of a program that will load data from a notepad or Excel file and load it into a ComboBox. The notepad file would have names and phone numbers in it. The ComboBox would only show their names in alphabetical order. There would also be a button that when you click it, it would open up Outlook (if you are signed into Outlook) and auto-fill the form with their phone number @ vtext.net (for texting verizon cell phones). The reason behind this is so the notepad or Excel file can be edited to add more users as the company expands.
how to do the data on load.
View 5 Replies
View Related
Jun 9, 2004
how to load an XML file into a DOM. I can get it done in IE, but in mozilla I am missing something. Here is what my loadXML() function looks like:
function loadXML(){
try {
xmlDoc = new ActiveXObject("Microsoft.XMLDOM");
xmlDoc.async = "false";
xmlDoc.onreadystatechange = verify;
hasFile = xmlDoc.load(info.XMLDocument);
if (hasFile){
xmlObj = xmlDoc.documentElement;
allTopics = xmlObj.getElementsByTagName("topic");
}}
catch(e) {
xmlDoc = (new DOMParser()).parseFromString(document.getElementById('info').innerHTML, 'text/xml');
hasFile = true;
allTopics = xmlDoc.getElementsByTagName("topic");
if (hasFile){
allTopics = xmlDoc.getElementsByTagName("topic");
alert(allTopics[0].firstChild.getAttribute("name"));
}}}
Where verify is another function. The try part works for IE, but the catch part doesn't work for Mozilla. I am not finding any information as to really use an XML DOM properly in Mozilla. I'm trying to get allTopics to be a handle on the same thing in both the "try" and the "catch".
View 8 Replies
View Related
Feb 15, 2012
I want to load data after loading related php page. i used ajax and even jquery.
jquery was not sure this is jquery code:
But this and when i was using ajax it changes data, but unfortunately, the pay now button (pay pal) was not working. curser changes but button don't work...
View 3 Replies
View Related
Apr 28, 2011
Here's what I'd like to do using pure JavaScript and HTML (no Ajax or PHP): My website loads different JavaScript files dynamically which contain a bunch of data, that I will display on the website. The dynamical loading function is placed in the <HEAD> and looks like that:
Code:
function loadJsFile(filename){
console.log("loading js file")
var fileref=document.createElement('script')
fileref.setAttribute("type","text/javascript")
fileref.setAttribute("src", filename)
fileref.onload = dataIsLoaded;
if (typeof fileref!="undefined"){
document.getElementsByTagName("head")[0].appendChild(fileref)
}}
The dataIsLoaded method in there is a callback that is triggered when the JavaScript file has been loaded:
Code:
function dataIsLoaded(){
console.log("loading js file done")
dataLoaded = true;
data = new Data();
}
DataLoaded is simply a global boolean that is per default false and the 'data' variable contains all the data I want to display on my site. While the JavaScript file is being loaded, the browser continues building the site. When it gets to the <body> that wants to access some information from the data variable, I get the unsurprising error that 'data' is undefined. I looked for a way to wait until 'data' is defined and then continue with building the <body> but couldn't find a solution.
Alternatively I wanted to reload the divs in the <body> when the 'data' is available:
Code:
function reloadDivs(){
if(dataLoaded){
console.log("data available, reloading divs");
document.getElementById('someDiv').innerHTML = document.getElementById('someDiv').innerHTML
}else{
console.log("data is not yet available");
setTimeout('loadReportData();', 500);
}}
This does not work, I get a blank div when I do that.
View 10 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Sep 4, 2010
I'm not sure how to make something draggable which is dynamically loaded. The click event works fine on the new content though.
Like for example [code]...
View 4 Replies
View Related
May 22, 2009
We are using jQuery JavaScript Library v1.3.1 for paging and sorting purposes. This library is working fine when we are loading smaller
data sets (<1000 records) on the page. However, when data set starts getting large (>3000 records), the initial page gives a script loading
error and the page does not load at all.
View 1 Replies
View Related
Apr 11, 2011
I am using jquery autocomplete combobox I load more than 25000 data. I set
minLength:3, delay: 700,
When I start typing three characters, in the third character ie8 shows the "Stop running this script" how to handle this huge amount of data
View 1 Replies
View Related
Oct 1, 2009
I am having a little problem trying to show a loader (An animated GIF) while some request to a database happens. I have a page where the user selects a YEAR and when they select it with AJAX I perform a request to a database to get all the values for that specific year.
The problem is that there is a lot of information (4000+ records) that I need to query and show in a table (Actually I didn't use a table I use DIVs that look like a table), and when the user selects the year the webpage freezes for about 5 seconds and then it loads all of the data.
Is there a way to sort of show an image loader gif while the data is being gotten? I tried putting the loader image in the DIV container while no year is selected and then once the request is done, I substitute the DIV container's contents (The image loader) for the data from the database.
[Code]...
View 1 Replies
View Related
Aug 14, 2011
Is Json considered the better file format for loadind data via Jquery AJAX? I am going to use it either way, but from a cutting edge stand point, is JSON looked at a more cutting edge since it loads faster. 2. And for that matter is anyone using css3 and E4X? All these seem to require the latest versions of all browsers. Since my goal is to be cutting edge I was thinking to do some stuff in the above listed that require only the latest browser if it is detected, if not use what works in most all browsers? What are cutting edge web app developers really doing at this time?
View 2 Replies
View Related
Jul 23, 2005
How can I partially update a page using javascript if javascript is
available, but do a full update if it's not, using php?
View 6 Replies
View Related
