We are using jQuery JavaScript Library v1.3.1 for paging and sorting purposes. This library is working fine when we are loading smaller
data sets (<1000 records) on the page. However, when data set starts getting large (>3000 records), the initial page gives a script loading
error and the page does not load at all.
I have a table I am populating with data from a DB, and have it
sortable on the client side. When the table exceeds around 300 rows,
I start running into problems with rendering and sorting it. I
started out using Prototype to help with the sorting, but it appears
that this results in a lot of calls to _getElementsByXPath, which are
taking up a large percentage of the rendering time. I believe this
call is occurring as the DOM is being parsed.
What is the general/most accepted manner of dealing with large data
sets (I am expecting some to grow into the thousands) in a table so
that it can be sorted client side? I am thinking of building a
javascript (JSON) object containing the data, and sorting based on
this. Anybody have any thoughts on this approach, or any suggestions
for other ways to approach this?
I am having a little problem trying to show a loader (An animated GIF) while some request to a database happens. I have a page where the user selects a YEAR and when they select it with AJAX I perform a request to a database to get all the values for that specific year.
The problem is that there is a lot of information (4000+ records) that I need to query and show in a table (Actually I didn't use a table I use DIVs that look like a table), and when the user selects the year the webpage freezes for about 5 seconds and then it loads all of the data.
Is there a way to sort of show an image loader gif while the data is being gotten? I tried putting the loader image in the DIV container while no year is selected and then once the request is done, I substitute the DIV container's contents (The image loader) for the data from the database.
[Code]...
I need a plugin or a idea about how to develop a pagination using jQuery (JSON dict coming from the DB (postgre)), but i cant get a list of all itens in the DB. I tried using offset and limit from the DB, but i didnt like the large algorithm. All i need is: develop a pagination that gives me only 20 rows from the DB (without calling a query to paginate all table from DB) and build a pagination with "first page, previous page, X-2, X-1, X, X+1, X+2, next page, last page" (X = number of actual page).
View 4 Replies View RelatedI'm working on a project that involves a page with a large amount of images (sometimes 400+). What's the best way to handle this? Should I track the loading-state of all of them, or is it save to assume I can do stuff as soon as the last image is loaded? So.
[Code]...
I have a coldfusion data component that receives two arguments and runs a stored procedure and returns a large data set. I want to use a textbox with autocomplete its data is that result set. I do not want to convert the result set to an array for performance.
View 1 Replies View RelatedI was looking for JQuery Grid which will help me more than 1000 - 2000 records. I mainly need search and paging .
View 1 Replies View RelatedI have this source code (I get "data" via AJAX / JSON and it has the properties person.id and person.lastname).
[Code]...
I searched for sorting them in an alpabetical order. I saw solutions, fetching the whole data, but I am rendering the HTML ul list, so perhaps there are better ways to sort it? Or is it necessary, first to push all the li's to the ul? Isn't there a jQuery basic function for it?
I'm requesting a very large JSON dataset for a table via AJAX and I'm building it on the fly with JQuery. What would be the most efficient way to build it?
View 2 Replies View RelatedHere's the situation: I have a simple php file which retrieves data from a
mysql database and displays it in a table. However, the number of records
has gotten so large that retrieving all the data takes a lot of memory and
the browser freezes.
I been googling for a solution and some1 mentioned something called live
scrolling where the data is retrieved only when you scroll up or down.
Since am just an amateur and not familiar with XML, XSL, etc; can any1
recommend some link where i could find some JS script with such a feature?
one that's easy to get started with if possible...
I am in the process of creating a site for real estate listings optimized for a mobile environment. One of the features that is desired would be a google map that loads listings as the user drags. One of the catches to this is that very few listings have included latitude and longitude values. Therefore, every time I need to add a listing to the map I first need to geocode it. Now with a few listings this is not really a big deal. However, the end goal would be to show all listings within the current bounds.Which depending on the zoom level could be anywhere from a hand full to several hundred.owever, when I attempt to load say 100 listings to the map it pretty much freezes and is fairly buggy after wards.
That said I was wondering if there is a better way to handle this. Perhaps submitting the listings as places with a CRON and having markers generated automatically? I am just trying to think how I can achieve this in a way which doesn't kill a mobile phone because it seems impossible considering there could be over 5000 listings in bounds of the map area. The only real solution I have is to only show say 30 or so and use pagination for the next 30 and so one within bounds.The ultimate goals is when the map bounds change ALL listings will show up within that bounds. The way I have currently approached this is that when the user stop dragging the map a asynchronous request pulls in ALL listings within bounds as an XML those full addresses are geocoded and added to the map. However, this is wrecking havok on the browser and I am not even going to try it in a mobile environment considering its dragging a desk top down. I'm thinking this is less and practical and pagination has to be used but perhaps someone out there has dealt with a similar objective.
I mainly do LAMP programming, and as such don't have much experience with JavaScript.
I'm looking for a simple function that will allow the user to reorder search data gotten from a database and displayed in a table.
Meaning, the user clicks on one of the column headers, and js automatically resorts the results. I've seen some stuff online, but none of it seems to really work.
Can anyone point me to something in the right direction?
I am using Ajax to send a large text box to a server script, however, when the textbox has a lot of data it fails. Is there a better way for me to do this? Here is my code.
Code:
<script type="text/javascript">
function testmail()
{
if (window.XMLHttpRequest)
{// code for IE7+, Firefox, Chrome, Opera, Safari
[Code]...
I've been using localStorage to store a large amount of data (> 5mb). I know that most browsers limit localStorage to 5mb. However, on the specification site it states,
Quote:
User agents may prompt the user when quotas are reached, allowing the user to grant a site more space. This enables sites to store many user-created documents on the user's computer, for instance.
Is this available yet? If so, how would I use it?
I am writing a form that grows using ajax server responses to info as the form is filled in and everything is fine in standards compliant browsers but IE is having a problem. I have two js functions on the page that collect form data, send it to the server, and then write the server response as innerHTML to specified divs on the page. This works great in FF but in IE it runs the first function but fails on the second function and the two functions are identical except for the server routine.
The div that is populated with the server response so it doesn't seem to be a problem with the coding because if one works, and they are identical, the other should work too so perhaps IE is choking with the way it is handling two ajax objects on the same page? You will need to add something to the shopping cart first at [uRL] and proceed to checkout, then on the checkout page look in the url and change ste_chkout_proc to ste_checkout_proc and load the new url to see the dev checkout vs. the live checkout.
I'm building an online auction system. Each participant will be allowed to post one bid per minute for about 3 hours. Each person's "bid history" must remain visible to him during the entire auction in a scrollable list, and this list must be sorted from high to low bid. These auctions will have upwards of 10,000 bidders and the server will be seriously stressed in dealing with so many bidders posting another new bid every minute. Therefore I want to alleviate any additional stress on the server by storing and sorting each bidder's "bid history" in his own browser -- perhaps in a cookie or maybe there is a better javascript-based data storage container available for this purpose ... ?
This seems like a natural application for javascript because of the fact that only the individual bidder needs to see his own list of submitted bids -- sorted from high to low -- and I'm hoping that javascript can be employed to do this.
1- A bidder enters his bid into a form (example 12345.67) and posts the form to the server;
2- Javascript grabs the posted value and appends it to the cookie or whatever container is storing the bids in the browser;
3- Javascript re-sorts the values and displays them again, perhaps in an iFrame or maybe in another kind of scrolling list on the main page.
Note that these bids will NOT be placed in ascending or descending order (this auction is different from most) and this means the values must be re-sorted each time a new value is posted -- so they always appear sorted from high to low in the list.
I have a JSON structure in API.When I call the API in my code it returns as the same JSON .I have to print this JSON result as table with pagination in Javascript. The table should be dynamic with previous and next buttons and the table should populate the results according to the JSON and each page should have 20 entries and then the remaining entries should go on the next page and I should be able to go back and forth in the table using previous and next respectively.tell me the exact code of how to start with getting JSON from the API and then write the JSON data in the form of dynamic table with pagination.
View 1 Replies View RelatedI am needing an accordion with dynamic data loading on each tier.
View 1 Replies View RelatedApologies if this is a fairly simple question! I'm fetching data (from a MySQL database), and would like to show an animated loading image while the data is being downloaded, and obviously then hide it when the data is fully downloaded. I've found plenty of tutorials describing how to achieve this is the other direction (i.e. when submitting a form) but I'm not sure how to adapt these to what I want.
View 2 Replies View Relatedi had created a test page for showing a grid for a task demo. I am supposed to fill it with dummy data for now.i have been using jqgrid for quite some time and many of the pages are working on some live projects also,but today i was unable to populate the data from an array.i have created a test script for you people to see, here also i am facing the same problem, i dont remember what all was required to fill it as it has been quite some months since i worked on jquery.this is the link for the test page
View 2 Replies View RelatedI have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
I'm not sure how to make something draggable which is dynamically loaded. The click event works fine on the new content though.
Like for example [code]...
I am using jquery autocomplete combobox I load more than 25000 data. I set
minLength:3, delay: 700,
When I start typing three characters, in the third character ie8 shows the "Stop running this script" how to handle this huge amount of data
Is Json considered the better file format for loadind data via Jquery AJAX? I am going to use it either way, but from a cutting edge stand point, is JSON looked at a more cutting edge since it loads faster. 2. And for that matter is anyone using css3 and E4X? All these seem to require the latest versions of all browsers. Since my goal is to be cutting edge I was thinking to do some stuff in the above listed that require only the latest browser if it is detected, if not use what works in most all browsers? What are cutting edge web app developers really doing at this time?
View 2 Replies View RelatedI've got a script that I'm using to render a list of links. The data comes from an xml file.
If I run the code in IE, I get all the data formatted the way I want it to.
If I run the code in Firefox, I get squat.
I suspect the problem lies in "xmlDoc.getElementsByTagName".
I'm using it to collect elements for rendering.
Any suggestions? Code:
I'm working with a pretty large XML file, but I really only need to
display a few things that requires quite a few transforms. I already
limited to the transforms to the data i need to use, but I'd like to
speed things up by loading only the data I need.
I need to mention that this is for a local application that sometimes
will lookup updates on a server, but mostly, it is for local use
(offline)
I can use xmlHTTPrequest for both local or server data access. That
seems to work fine. Now I would like to be able to load only the data
I need.
I hear the Google suggest tool bar uses xmlHTTPrequest to look up a
list of known queries, so I am hoping they lookup "only" the necessary
data as one types. It's kinda what I want to do, but I'm not sure how
that would work, since the "url" parameter should be a destination
file name.