JQuery :: Accordion With Dynamic Loading Data
Jul 16, 2009I am needing an accordion with dynamic data loading on each tier.
View 1 Replies
ADVERTISEMENT
JQuery :: Make Dynamic Data Draggable After Loading From Server?
Sep 4, 2010I'm not sure how to make something draggable which is dynamically loaded. The click event works fine on the new content though.
Like for example [code]...
JQuery :: Accordion - Dynamic Sizing Of Content Box?
Oct 18, 2011I am new to jQuery and not an experienced programmer. I downloaded the accordion widget and it works fine. I have one small problem: the content box instances 2 and3 onwards, seem to be sizing themselves depthwise to the size of the first content box and not dynamically to the number of lines of text I enter in each. Can I make it dynamic with alterations to the CSS? If so whichproperty do I alter and to what?
View 1 Replies View RelatedJQuery :: Dynamic Load Of Content In An Accordion Structure?
May 31, 2011I'm trying to make an accordion structure, load dinamically content. This what i done, and that's work, but now i need to improve it.
Here the css
<style>
.project { display:none; }
</style>
<div id="project-box">
[Code].....
JQuery :: Dynamic Accordion Leaving A Lot Of Extra Space?
Feb 1, 2011I have an accordion in which all the data is being populated from a database. The problem is that after it runs through the query and adds my data it leaves alot of extra spaces which leads the user to have to scroll a great deal before finding the next header.
Here is my code.
<?
$sqlQuery = "SELECT id, date, name FROM webinars ";
$result = mysql_query($sqlQuery);
?>
[Code].....
Jquery :: Post - How To Make The Variable Data - [data] - Dynamic?
Aug 21, 2009I wonder if i can make the variable data which is [data] in jQuery.post( url, [data], [callback], [type] ) dynamic. for instance, this is the form i want to send,
PHP Code:
<form action="send_xml.php" method="post" enctype="multipart/form-data" id="form_send"><input type="checkbox" id="var_1" class="checkbox"/><input type="checkbox" id="var_2" class="checkbox"/></form>
[Code]...
Site Loading Delay (JS Accordion Effect Doesn't Load Right Away)
Jun 10, 2011Ok i just created my portfolio site using a simple accordion effect i got from. [URL] Im very new to javascript and coding in general, so im sure my code is far from pretty. My question, is their a way to fix the delay on the way the accordion loads. if you go to my site [URL] you'll see that initially all the sections are visible and then they collapse after a few moments. is there anyway to make it so they are collapsed immediately.
[Code]....
JQuery :: Accordion - Stop The Rollover Effect In The Sub Menus Until The Accordion Animation Is Finished?
Aug 5, 2010I created an accordion menu with rollover sub menus. My question is there a way to stop the rollover effect in the sub menus until the accordion animation is finished? When I click on a category link on the accordion the sub menu links flashes until the animation is done.
View 1 Replies View RelatedJQuery :: Difference Between Accordion Widget UI And Accordion Plugin?
Oct 1, 2009explain to me the difference between the two? I just finished an online tutorial on Accordian Widget UI and it
View 5 Replies View RelatedJQuery :: Dynamic Loading - Create Portlets That Dynamically Load Their Content
May 29, 2009I am trying to create portlets that dynamically load their content (usinq jQuery). My first approach was to leave the header + footer + decorations of the portlet OUTSIDE of the dynamically loadable content. It worked just fine but I had to abandon that approach so that I could use the same code both for statically- and dynamically-loaded content (e.g. when no AJAX support was available). So far so good.
Now to my problem: I use the following code for loading my dynamic content
The loading works fine, but after the dynamic content has been loaded I can not seem to get access to it using jQuery!
Short description: Line 3 clears the content (I know! There are better solutions!) Line 4 loads the content Line 6 dumps the data on the console; this is for debuging only, so that I can establish that the correct content is loaded
After the data is properly loaded I did expect to be able to find it by traversing the DOM tree in traditional jQuery fashion (like in Line 10). However, dumping the contents of the 'tag' shows it containing no content at all; it is empty even though the browser renders the expected new result. I thought: Well! The browser holds two copies of the DOM tree; one that is the original page and one that is the modified content used for rendering". Therefore I attempted to manipulate the loaded content within the function (Line 8). The content is visible there, that I have established in Line 6. But I do not know how to access it jQuery-style.
(Why am I trying to modify the loaded content? I want to inject a title row with various decorations and clickable content.)
JQuery :: Loading Image While Fetching Data?
Aug 11, 2010Apologies if this is a fairly simple question! I'm fetching data (from a MySQL database), and would like to show an animated loading image while the data is being downloaded, and obviously then hide it when the data is fully downloaded. I've found plenty of tutorials describing how to achieve this is the other direction (i.e. when submitting a form) but I'm not sure how to adapt these to what I want.
View 2 Replies View RelatedJQuery :: Loading Array Data Into A Jqgrid?
Jan 12, 2011i had created a test page for showing a grid for a task demo. I am supposed to fill it with dummy data for now.i have been using jqgrid for quite some time and many of the pages are working on some live projects also,but today i was unable to populate the data from an array.i have created a test script for you people to see, here also i am facing the same problem, i dont remember what all was required to fill it as it has been quite some months since i worked on jquery.this is the link for the test page
View 2 Replies View RelatedJQuery :: How To Access Dynamic Data
Aug 27, 20091 ) how do i access ajax generated data? i have a select boxpopulating via another select. like this:
$("select#parent").change(function(){
var path='json.provider.php';
var options = '';
[code]....
JQuery :: Dialog With Dynamic AJAX Data?
Jun 1, 2010I am creating a dialog using jQuery, and want to populate it with dynamic data. The data in question is properly formatted XML (parsed using jQuery). The call I make looks something like this:
function getXML() {
var $link = $(this);
var $dialog = $('<div></div>')
.load('xml_results_formatted_jquery.php' + ' #dialogcontent')
[Code]....
If I preview the xml_results_formatted_jquery.php file, I see the data so I know the webservice is being queried correctly. However, when I call my function above, the dialog box created has no text in it (apart from the text already present in the dialogcontent DIV). The bit that shows the results of the XML parse is empty.
JQuery :: Cluetip With Dynamic Data From Textarea?
Sep 18, 2009I am using the cluetip plugin to show a formatted version of text thatthe user types into a text area. So I have a <textareaid="description">, and as the user types, they can at any time click a"preview" button will call cluetip to display the popup. Here is mycurrent cluetip call:
$('#id_preview_link').cluetip(
{
ajaxSettings: {dataType:'html',
[code]....
JQuery :: BlockUI : Not Working When Html Page Is Loading Data?
Aug 9, 2010I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
JQuery :: Loading / Handling Large Data For Sorting And Pagination?
May 22, 2009We are using jQuery JavaScript Library v1.3.1 for paging and sorting purposes. This library is working fine when we are loading smaller
data sets (<1000 records) on the page. However, when data set starts getting large (>3000 records), the initial page gives a script loading
error and the page does not load at all.
JQuery :: Autocomplete Combobox - Loading Huge Amount Of Data
Apr 11, 2011I am using jquery autocomplete combobox I load more than 25000 data. I set
minLength:3, delay: 700,
When I start typing three characters, in the third character ie8 shows the "Stop running this script" how to handle this huge amount of data
JQuery :: Show Loader While Loading Large Amounts Of Data?
Oct 1, 2009I am having a little problem trying to show a loader (An animated GIF) while some request to a database happens. I have a page where the user selects a YEAR and when they select it with AJAX I perform a request to a database to get all the values for that specific year.
The problem is that there is a lot of information (4000+ records) that I need to query and show in a table (Actually I didn't use a table I use DIVs that look like a table), and when the user selects the year the webpage freezes for about 5 seconds and then it loads all of the data.
Is there a way to sort of show an image loader gif while the data is being gotten? I tried putting the loader image in the DIV container while no year is selected and then once the request is done, I substitute the DIV container's contents (The image loader) for the data from the database.
[Code]...
Dynamic Loading Of <script>?
Mar 27, 2010I have a code that adds dynamic text to a page:
Code:
document.getElementById("dynamic").innerHTML = text
However, sometimes the text contains actual javascript. It seems it won't run because the page already loaded.
add a child, etc. to get it running? The steps are: Display the part before the script. Run the script. Display the part after the script.
For example:
Code:
text = "display this text, run this code <script>alert('foobar')</script> and then display this text."
JQuery :: Mobile Select Box Dynamic Data Population?
Dec 13, 2011I am using JQuery Mobile . I have populated Select box with dynamic data, The UI shows just one item populated, rest does not get rendered , here's code. The option loop iterates 5 times but the select box just show one item when renderd. Is it Jquery mobile the select box cannot be populated dynamically?
var options ='';
$("#select-choice-1").empty().append(function() {
$.each(data.maps,function(key, value){
options += '<option value="' + i + '">' + value + '</option>';
[Code]....
JQuery :: Json Considered The Better File Format For Loading Data Via AJAX?
Aug 14, 2011Is Json considered the better file format for loadind data via Jquery AJAX? I am going to use it either way, but from a cutting edge stand point, is JSON looked at a more cutting edge since it loads faster. 2. And for that matter is anyone using css3 and E4X? All these seem to require the latest versions of all browsers. Since my goal is to be cutting edge I was thinking to do some stuff in the above listed that require only the latest browser if it is detected, if not use what works in most all browsers? What are cutting edge web app developers really doing at this time?
View 2 Replies View RelatedAjax :: Loading The Dynamic Content?
Nov 20, 2011I've been trying to get this to work, but it will not load my test.html website into my div named Content, I also downloaded the demo found here :[URL]But I cant get that to work either, what am I doing wrong?
Here is my code. :
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
[code]....
JQuery :: Getting Dynamic Values From MySQL Data Displayed Via PHP/HTML
Jul 6, 2009I have multiple rows of data in an HTML table. E.g., financial transactions. In each row I have an HTML dropdown SELECT with options (user will select transaction tag). I want the transactionID and selected tagID to pass to an onchange event for that unique row. The transactionID comes through for the unique row of data, but I
[Code]...
JQuery :: JCarousel - Set Start Variable Based On Class With Dynamic Data
May 6, 2009I have a dynamic jCarousel which pulls in JSON data from php, and prints out the list html. What I'm trying to do is set the carousel start item as a variable, which would find the item with the class ".active", and start with that item. The problem is that since the data is dynamic when it looks for the start item, the list hasn't yet been rendered, therefore doesn't find any class or list data. The code below works with a static list, but not dynamic. I think my options are (a) wait for carousel to load, then somehow set the "start" item after, or (b) after list loads auto-scroll to the item with class ".active".
Here's the code i'm working with for the dyamic list:
------------------------------
<script language="javascript">
$(document).ready(function() {
/* create an image slideshow from a JSON array using jcarousel */
[Code]....
Problems Loading Dynamic Content Into FireFox Divs (XMLHTTP)
May 6, 2007I wrote an "ajax" script that pulls dynamic content into a div container via xmlhttp. There is a variety of lists on this page that are all ajax. Basically the up/down arrows in the Music, Photos, Users, Community etc boxes have this javascript funtion that replaces the innerHtml properties of a div to some response data from an asp.net object.
In IE these up/down arrows works fine and pull in data, but in FireFox the divs come up with "Undefined" in the div instead of the data.. Code: