Apologies if this is a fairly simple question! I'm fetching data (from a MySQL database), and would like to show an animated loading image while the data is being downloaded, and obviously then hide it when the data is fully downloaded. I've found plenty of tutorials describing how to achieve this is the other direction (i.e. when submitting a form) but I'm not sure how to adapt these to what I want.
View 2 Replies
I want that data against each option should be loaded as the option is selected in the combo box. As, while registering on yahoo, when we select a country all provinces of that country are loaded. (No need to click a submit button.)
View 1 Replies View Related<span style="font-family: courier new,monospace;">Hello all,</span><br style="font-family: courier new,monospace;"><br style="font-family: courier new,monospace;"><span style="font-family: courier new,monospace;">I've recently started with jQuery because I wanted to use it for posting details from an login form to a PHP script which should return whether the user is authenticated ox not.</span><br style="font-family: courier new,monospace;"> <br style="font-family: courier new,monospace;"><span style="font-family: courier new,monospace;">For this I use $.ajax, because of it's flexibility and I prefer to use it in this implementation. Reading (jQuery docs and examples) and searching a lot did not solve me on one issue: fetching the data in the callback to the global scope.
</span><br style="font-family: courier new,monospace;">
<br style="font-family: courier new,monospace;"><span style="font-family: courier new,monospace;">Here is the code:</span><br style="font-family: courier new,monospace;"><font style="font-family: courier new,monospace;" size="2"><script type="text/javascript">
[Code].....
how can I let the function that should check the message of the response know that 'msg' has been set?
I want that data against each option should be loaded as the option is selected in the combo box. As, while registering on yahoo, when we select a country all provinces of that country are loaded. (No need to click a submit button.)
View 3 Replies View RelatedIs there any way I could fetch data from another web page?
Things like current weather, and rate of exchange?
I would search the data for example by
-loading a web page somehow (IFRAME?)
-going through all <td> tags in it and
-if the <td> had a spesific text, like "weather in Fooland" then
-I'd jump to the next <td> tag and take the text inside it, that hopefully had the data I was looking for.
I used an IFRAME to load a web page. It's id is called "myiframe"
var myIframe = document.getElementById("myiframe")
var iframeBody = myIframe.body;
var paragraphs = iframeBody.getElementsByTagName("p");
document.write(paragraphs.length); //this writes 0!
the page I loaded on the IFRAME has paragraph elements right on body. Why can't I find them?
I tried using node iterator (document.createNodeIterator() ? ) too, but that didn't work at all! I tried it without the IFRAME too. If you have any guesses what it might be, please tell me. Should it work in Mozilla? Should I create the node Iterator only after the page has finished loading?
I am having trouble sending JSON data to a server. Its definitely reaching the parser.php, but I am not what to create in PHP to fetch this data. Also I am not sure my Javascript is correct.
<SCRIPT>
var JSONObject = new Object;
JSONObject.description = "hello";
JSONstring = JSON.stringify(JSONObject);
runAjax(JSONstring);
[Code]...
I have my doubts if this question belongs to the javascript side since it's all good until the data from MySQL comes in, but since the javascript is the one breaking I'll take my chances.
The external js (portada.js)
Code:
$(document).ready(function(){
var currentPosition = 0;
var currentPosition2 = 0;
var currentPosition3 = 0;
[Code]....
As you can see I have three divs with different slideshows (slideshow, slideshow2 and slideshow3), they have products that slide to the left. When I was testing to make sure it all looks good the sliding feature was working fine, but I lost this feature when the data was being retrieved from MySQL (at the moment on <div class="slide">).
I already know that i can change the src of an image-tag with jquery / javascript.BUT my problem is, that I try to load the new src-information from a dynamic html-sheet.So every 1 second the image src should be refreshed.
Some of my code:
<script src="jquery.js"></script>
<script>
var auto_refresh = setInterval(
[code]....
You can see in line 17 that it is no problem to show the fetched data from the other html-file in a div every 1 second.But I would like to change a picture dynamically.That means in detail:in the other html file stands either the value "0" or the value "1".This value should be fetched every 1 second (like the div-refresh) from the file.Then the value should be used as new src-name for the refreshing image, e.g.:fetched value = "1" => img src = "1.jpg" => [user can see a green light]fetched value = "0" => img src = "0.jpg" => [user can see a red light]How can I achieve this?
- How can I change the src name
- How can I refresh the image every 1 second with the new src name?
I have this loading.gif image that is 750px, when it should be 32px. The reason it's huge now is because my original solution was displaying two images: one 750px version of the loading.gif image and one 32px version (in the center of the 750px) of the same image. Now I'm at least down to one image, even if it's the wrong version.Click any of the thumbnail images here, and then again on the thumbnail at the top of that popup product gallery to see what I mean: need that huge loading.gif to be 32px like it should be, and then expand to 750px once the image is loaded. I've tried a bunch of solutions, but nothing has solved the problem.This is the code I have at the moment, although I'm working on the issue now so it may change.
$('#inline .thumbGrid img').click(function(){
var strLargeImg = document.getElementById('OBOEsac');
$('.galleryPopup').attr('src','/site/scripts/colorbox/images/loading.gif');
[code]....
How to display loading gif image until the big image have loaded? Now I have the html and js but it doesn't work. Anyone have some idea or solution ?
[Code]...
I am needing an accordion with dynamic data loading on each tier.
View 1 Replies View Relatedi had created a test page for showing a grid for a task demo. I am supposed to fill it with dummy data for now.i have been using jqgrid for quite some time and many of the pages are working on some live projects also,but today i was unable to populate the data from an array.i have created a test script for you people to see, here also i am facing the same problem, i dont remember what all was required to fill it as it has been quite some months since i worked on jquery.this is the link for the test page
View 2 Replies View RelatedI have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
I'm not sure how to make something draggable which is dynamically loaded. The click event works fine on the new content though.
Like for example [code]...
We are using jQuery JavaScript Library v1.3.1 for paging and sorting purposes. This library is working fine when we are loading smaller
data sets (<1000 records) on the page. However, when data set starts getting large (>3000 records), the initial page gives a script loading
error and the page does not load at all.
I am using jquery autocomplete combobox I load more than 25000 data. I set
minLength:3, delay: 700,
When I start typing three characters, in the third character ie8 shows the "Stop running this script" how to handle this huge amount of data
I am having a little problem trying to show a loader (An animated GIF) while some request to a database happens. I have a page where the user selects a YEAR and when they select it with AJAX I perform a request to a database to get all the values for that specific year.
The problem is that there is a lot of information (4000+ records) that I need to query and show in a table (Actually I didn't use a table I use DIVs that look like a table), and when the user selects the year the webpage freezes for about 5 seconds and then it loads all of the data.
Is there a way to sort of show an image loader gif while the data is being gotten? I tried putting the loader image in the DIV container while no year is selected and then once the request is done, I substitute the DIV container's contents (The image loader) for the data from the database.
[Code]...
I am usign $.post() method to post selected value in a drop down to server. On server-side I fetch resultset based on the selected value, and serialize the result set via the Response object which is fetched by the on Success function within $.post. How can set the textbox values conatined within that result set to those textboxes? Rather how can I fetch each of the values out from that response object in JQuery?
View 1 Replies View RelatedIs Json considered the better file format for loadind data via Jquery AJAX? I am going to use it either way, but from a cutting edge stand point, is JSON looked at a more cutting edge since it loads faster. 2. And for that matter is anyone using css3 and E4X? All these seem to require the latest versions of all browsers. Since my goal is to be cutting edge I was thinking to do some stuff in the above listed that require only the latest browser if it is detected, if not use what works in most all browsers? What are cutting edge web app developers really doing at this time?
View 2 Replies View RelatedI have created a party-events website. Which displays a lot of dates of events. As you might understand this page takes some time to load. Therefor I want some of loading image to be displayed while the page is loading. Anybody has an idea how to pull this of? I don't know how.
In detail: People come to my website. They click on "events" and a loading.gif pops up and and makes the background darker. After the page has completely loaded the loading image disappears and the website shows.
In one of my web page I want to show an image preloader. ie When I clicked on the small thumbnail in my web page then the main large image will load. My code looks something like this
$("#images li").click(function(){
var image=this.href;
$("#mainImage").attr('src',image);
});
I want to show the Loading sign until the main image loads completely.
I have written some JAVA code that pulls and image from a DB and writes out the byte stream.When I call the URL directly I can see my image, however when I use something like:
function loadImage(filename) {
$(document).ready(function() {
alert('loadImage Called with ' + filename);
[code]....
I am attempting to stop the loading and replace images with processed ones using the below code, the problem seems to be that even though I am removing the src attribute the original image still loads.
[Code]...
I have the following navigation links:
HTML Code:
<a href="images/apollohaga.jpg" title="a" id="productlink">Num 1</a><br />
<a href="images/apolloherr.jpg" title="b" id="productlink">Num 2</a><br />
<a href="images/apollodam.jpg" title="c" id="productlink">Num 3</a><br />
[Code]....
I have tried all sorts of things to get this working but no luck so far.
I've got a script that I'm using to render a list of links. The data comes from an xml file.
If I run the code in IE, I get all the data formatted the way I want it to.
If I run the code in Firefox, I get squat.
I suspect the problem lies in "xmlDoc.getElementsByTagName".
I'm using it to collect elements for rendering.
Any suggestions? Code:
I want add loading image before load content in bellow template.but I do not know what to do!
View 5 Replies View Related
