JQuery :: BlockUI Not Working With Layout?
Oct 27, 2009I am trying to block the whole page, but blockUI is not working with my layout (like the simple layout in demo).
View 1 Replies
ADVERTISEMENT
JQuery :: BlockUI Scroll - Slight Usability Bug With BlockUI
Feb 1, 2011I noticed a slight usability bug with blockUI. when we block, with a message div - the page is still scrollable. however the message div that comes up, stays where it is, as user scrolls the page. So for example, if the vertical screen resolution is low, the user can not see the bottom of the message div, and in my case the message div has some appept or cancel buttons, which makes my UI unusable?
Are there any workarounds to this solution, other then placing the message div to the top of the page?
JQuery :: Not Working 100%, Animation, Layout?
Nov 1, 2009The only issue I can't figure out is the image will not align to the left. I tried numerous things but I'm whooped.
<html xmlns="http://www.w3.org/1999/xhtml" >
<head id="ctl00_Head1"><meta content="text/html; charset=utf-8" http-equiv="Content-Type" /><title>
[code]....
JQuery :: BlockUI : Not Working When Html Page Is Loading Data?
Aug 9, 2010I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
JQuery :: BlockUI Breaks Under 1.4.1
Mar 24, 2010Have a asp.net mvc project using jquery-ui-1.7.2. and BlockUI. When I changed jQuery version from 1.3.2 to 1.4.1, the CSS pertaining to the block ceased to render. The functions fired (verified by in-line alerts) and firebug had no complaints. Moved back to 1.3.2 and the blocker rendered perfectly.
View 2 Replies View RelatedJQuery :: BlockUI Not Always Firing?
Jun 2, 2009I posted this in the UI group and was told to put it in here... My problem is that I have a function that is to call blockUI both upon login and logout. BlockUI only fires upon logout.
Here's my code:
**code**
function Processing(dataString,l_processing,control)
{
if (l_processing == "yes")
{
[Code].....
JQuery :: BlockUI 2.31 Throws A Error In FF 3.6.10
Sep 22, 2010When using blockUI, sometimes I get an error on line 462 of the code, near the end of the handler function:
This may or may not be due to firing multiple .block() events on the same element.
The problem seems to be limited to Firefox; IE8 & Chrome 6 work without an error. I have tested this on multiple Firefox installations.
I have a fix that checks to see if opts has been defined as a closure prior to its use:
If you could include this in your next version, that'd be great!
JQuery :: BlockUI - How To Set Min Time For Start
Oct 25, 2010I use simple code
[Code]...
JQuery :: BlockUI Is Not Submitting Forms
Aug 10, 2010BlockUI is not submitting forms! Did I do something wrong? Please help by pointing me to the right direction.[code]
View 1 Replies View RelatedJQuery :: BlockUI Overlay Will Not Close
Dec 1, 2011I have an overlay that is implemented using Malsup BlockUI, with a "close" button, however it won't close! - here's the details... I have a DIV that I use as an overlay:
<div id="mp" style="display: none; cursor: default">
<p>.....</p>
<ul><li>A</li><li>B</li></ul>
<div>
<span class="divbutton greenbutton mp_no" style="margin-right: 1em">not now thanks</span>
<span class="divbutton greenbutton" style="margin-right: 1em">
<asp:HyperLink ID="hypView" runat="server" style="text-decoration: none" NavigateUrl="~/mp.aspx">blah</asp:HyperLink>
</span></div>
</div>
Displayed using:
$.blockUI({ message: $("#mp").html() });
It has a cancel button (see above):
...
<span class="divbutton greenbutton mp_no" style="margin-right: 1em">not now thanks</span>
...
Which closes the overlay by means of :
$('.mp_no').click(function() {
alert("close overlay");
$.unblockUI();
return false;
});
However like I say, this simply refuses to close the overlay. I've used this same technique over and over again but this time something must be wrong. I just can't spot it! Moreover... if I place a button elsewhere on the page (and outside of the overlay DIV):
<span class="divbutton greenbutton mp_no" style="margin-right: 1em">not now thanks</span>
This will fire the click event, and is exactly the same "button" markup!
JQuery :: BlockUI For All Buttons And A Tags?
Jan 5, 2010I have implemented blockUI for all buttons and a tags, using a custom message as shown:
<script type="text/javascript">
$.unblockUI
;
$
document
[Code]....
JQuery :: BlockUI Transparent Borders?
Aug 15, 2009how can I have transparent borders for modal divs that I bring to frond have transparent borders? specifying: border: 10 px transparent yellow; in the settings.css will not work. I tried few things, and I am beginning to think it is not doable.
View 1 Replies View RelatedJQuery :: BlockUI Plugin (v2) Add OnBlock()?
Jan 6, 2010in this plug-in I need a function like onUnblock but on completedfadein..
View 1 Replies View RelatedJQuery :: Use BlockUI For Page Loading?
Oct 20, 2011I'm sure this is simple to solve but I'm a newbie and I'm not sure what to do. I want to use the BlockUI plugin to show "page loading..." while my asp.net page loads some data - takes around 20 seconds. Once the page is fully loaded, I want the message to go away.
View 5 Replies View RelatedJQuery :: Blockui Not Honoring Top Margin Setting In IE 6?
May 4, 2011I'm trying to set a modal to the top right corner of the screen using block ui. In IE 6 the right margin is working, but it's ignoring the top margin and centering the modal in the window. In other browsers it behaves as expected
View 1 Replies View RelatedJQuery :: BlockUI 1.33 Crashing Internet Explorer?
Jul 15, 2009I am using the BlockUI Plugin version 1.33 with Jquery Version 1.2.1. When the application page is accessed in which the block and unblock UI calls are executed, IE is crashing randomly.
View 2 Replies View RelatedJQuery :: Blockui V2.20 - Hourglass Cursor Stays In IE 7+?
Aug 3, 2009You should be able to replicate this on http://malsup.com/jquery/block/#pageGo to the page above and click on "Default Message" button and makesure you don't move the mouse cursor.You should see that the cursor remains a hourglass even after the pagecomes back, to get the correct cursor you have to move the mouse.
View 1 Replies View RelatedJQuery :: Use BlockUI Inside User Control In .NET ?
Oct 1, 2009I am a ASP.NET developer and I would like to use the jQuery BlockUI inside a generic control, designed to show a popup (with javascript and CSS effects). My problem is to disable (key tab, enter and mouse clicks) the parent window (parent element) (my control is inside the page and does not use iframe). Inside my control I have a DIV and I show his content when the user call the method designed. The problem is: I only see the "caller" of BlockUI using this type of eventhandler "CLICK", ex:
$('#pageDemo2').click(function() {
$.blockUI({ message: '<h1><img src="busy.gif" /> Just a
moment...</h1>' });
test();
});
It is possible apply that property inside the blockUI out of my DIV (parent element), inside my control, without click ? Is it necessary to use a iframe?
JQuery :: Loading A Page In An Iframe With BlockUI?
Jul 29, 2009How would you load a separate page in an iframe with BlockUI? I tried: forceIframe:true, iframeSrc:'/iframepage.html' but BlockUI still creates the default "Please wait..." overlay, but also creates a seemingly separate iframe overlay, but without applying any of the CSS properties to it. If BlockUI doesn't have this functionality, so any of the other overlay plugins support it? I've tried jqModal and SimpleModal, but none of them seem to explicitly support this.
View 3 Replies View RelatedJQuery :: Unable To Use BlockUI And The Form Plugin
Aug 20, 2009I'm calling blockUI and then running ajaxForm on my whole page form. BlockUI is firing an overlay (with form field content) but only after the form has been ajaxed. Because of this my fields aren't seen as in the form and so subsequent form submits fail. Firebug says: form is null, /assets/js/jquery.form.js, Line 364 (form.clk = this;) The longer version:The javascript for these events are being returned to taconite within<eval> blocks. They are coming back in the below order: blockUI on whole page I then call a custom function which contains the "$('#page- form').ajaxForm({ dataType: 'xml' })"; When I alert inside that custom function it occurs before any blockui overlay is shown. I'm surmising that this is breaking the form submit for elements within the blockui message (which are actually already on page but hidden).
I've tried adding alerts before and after blockui is called and they run in the correct order so I'm guessing that perhaps blockui queues itself to run somehow. BlockUI doesn't have any after block callbacks that I'm aware of. I'm wondering if I can add a beforeSubmit callback to the ajaxForm method that calls itself to update the form but that just feels a bit dirty. I use the framework that I've put together extensively and it's only when adding blockui that I have this issue so I'm (at least fairly) sure that it's not a PEBKAC issue.
JQuery :: Layout Move On Click?
Apr 23, 2010I use Accordion into a tab and I have a particular problem just on FF.. When I click an accordion header the whole layout move on the left side ... This is the page, so you can see my problem: [URL]
View 5 Replies View RelatedJQuery :: Dynamic Layout Creation With MVC?
Jan 10, 2012I just wonder if there is a jquery plugin or something that enable me to create a html pagelayout with drag n drop.
Lets say i have a blank page with a div container, then i have a couple of layout elements that i can drag into that container, like 2 coulmn, 1 column, 3 column.
I hope you understund what i mean. something like sitefinitys template builder but in a light version.[URL]
Jquery :: Tools Breaking Layout In IE7 And 8
Jul 17, 2010I subcontracted a programmer who replaced my jquery.js with a different version of jquery. This version breaks my function, but my version breaks the layout. I have a function that works with
Code:
jquery.tools.min.js
But not with
Code:
jquery.js?ver=1.4.2
Here's is my function:
Code:
<SCRIPT type="text/javascript">
$(document).ready(function(){
$('.theVideoLink').click(function(e){
e.preventDefault();
$('#VideoContent').load($(this).attr('href'));
});
});
</script>
I need this code to work with
Code:
jquery.js?ver=1.4.2
But it doesn't. It works with
Code:
jquery.tools.min.js
But this jquery.tools.min.js breaks the layout in IE7&8.
JQuery :: Layout Only Works In Firefox 3.6.x
Jun 25, 2010I have scroll and pagination jQuerys for a website that I am developing for a company. The jQuery works fine on all browsers until I updated firefox to 3.6.3. On FF 3.6.3 the page loads fine but once the scroll or pagination is clicked on to change pages, the entire content shifts up 200px. I was unable to find any known bugs with FF and jQuery except for certain jQuery pages not being able to load but that seems to have been resolved. I am stumped with this problem and was hoping that maybe someone would know how to resolve this. I have tried using JavaScript to detect the browser and version to load a different css but that caused the page to load weird and jQuery fixed it after scroll or pagination was activated.
I was able to deduce that the problem must be with the two columns float left and right which are position relative, but still am unable to figure out why once the pagination or scroll is clicked the columns should shift... Let me know if more information is needed, such as page source. (I will do my best to disclose all relevant information to the extent permitted by the company).
JQuery :: Implement The Growl Option For The BlockUI Plugin?
Aug 21, 2009I'm trying to implement the Growl option for the blockUI plugin, the "hard" way ( as seen here: http:[url].... second to last example). The reason why I'm going the "hard" way is because I'd like to have multiple Growl messages - one for an error,one for a success, etc, all of which have different background images / styles (ex: a red X for error, a green checkmark for a success).The "easy" growl method, while allowing for different text content,only allows for one style. Thus I'm trying to get around this limitation using the "hard" way:
$.blockUI({
message: $('div.growlUI'),
fadeIn: 700, [code]...
subsequently adding different styles in my stylesheet. Yet I get an error that says "data.parent = node.parentNode", when I try and run the above code. Has anyone had any luck getting *different* growl messages with different styles/images in them to run on the same page?
JQuery :: Tablesorter - Errors With BlockUI And Unblock Functions
Apr 8, 2010When I am using tablesorter , jquery.blockUI.js as well as the blockUI() and unblock() functions it will give error, Iam using jquery 1.4.2. Also what will be the solution if some of my older jquery functionalities not work with new jQuery 1.4.2.
View 2 Replies View Related
