JQuery :: Loading A Page In An Iframe With BlockUI?
Jul 29, 2009
How would you load a separate page in an iframe with BlockUI? I tried: forceIframe:true, iframeSrc:'/iframepage.html' but BlockUI still creates the default "Please wait..." overlay, but also creates a seemingly separate iframe overlay, but without applying any of the CSS properties to it. If BlockUI doesn't have this functionality, so any of the other overlay plugins support it? I've tried jqModal and SimpleModal, but none of them seem to explicitly support this.
View 3 Replies
ADVERTISEMENT
Oct 20, 2011
I'm sure this is simple to solve but I'm a newbie and I'm not sure what to do. I want to use the BlockUI plugin to show "page loading..." while my asp.net page loads some data - takes around 20 seconds. Once the page is fully loaded, I want the message to go away.
View 5 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Aug 18, 2009
I am loading a collection of frames as follows (from jsp source, so ignore <%= %> blocks):
<html>
<frameset name="MNGM_OUTER" rows="50,*,20" framespacing=0
frameborder=0 border=0>
<frame name="MNGM_TOP" src="control/top.jsp" scrolling=no
[Code].....
View 1 Replies
View Related
Mar 19, 2010
I have a lot of javascript functions that request information from an iframe hidden on the page. I see other sites do this, but their browser does not do the loading action (like the processing circle in Firefox). When I do it on my site, each browser shows the loading icon, as if a page was loading. Is it possible to not have this?
http://bit.ly/cv1YqN
That is a sample link. Go down right side of page where you see three buttons: Trailers Featurettes Clips.Those return iframe information to work.
View 4 Replies
View Related
Oct 11, 2009
i want to make a iframe page that loading a page from other site. I have try "jQuery iFrame Sizing" to set auto height in iframe... but it is failed.
This is my code :
-------------
on Head
<script type="text/javascript" src="js/jquery.js"></script>
<script type="text/javascript" src="js/iframe.js"></script>
on Body
[Code]....
View 1 Replies
View Related
Feb 1, 2011
I noticed a slight usability bug with blockUI. when we block, with a message div - the page is still scrollable. however the message div that comes up, stays where it is, as user scrolls the page. So for example, if the vertical screen resolution is low, the user can not see the bottom of the message div, and in my case the message div has some appept or cancel buttons, which makes my UI unusable?
Are there any workarounds to this solution, other then placing the message div to the top of the page?
View 1 Replies
View Related
Oct 30, 2009
i have the following
<script type="text/javascript">
$(document).ready(function () {
window.name = "main";[code]....
works perfectly but the main page keeps loading once the iframe is removed. Any know why and how i can terminate the loading?
View 8 Replies
View Related
Jul 14, 2010
is the .wait function/property/attribute relevant?Basically I have a system to test for final loading but it relies on links.length (or "TD" etc)and is not fool-proof.What attribute should I be looking at to see completion of loading?
View 9 Replies
View Related
Nov 25, 2010
i am loading a page into an iframe...
Code:
<iframe src="http://www.cult.co.uk/men/shop/hoods-and-sweats/details/25705/75-wings-foil-hood" width="500" height="500" id="iframeTest"/>
the page from cult.co.uk has javascript alert() messages embedded in the code, which are triggered when the page loads via the iframe.is there a way of suppressing the alert() messages?I know i can suppress alerts on my local site by adding the following function:
Code:
function alert(){};
View 1 Replies
View Related
Dec 13, 2010
I'm loading an html page into an iframe from an onclick event. The procedure is to put a number into a textfield and then click a button that loads a separate file into the iframe. The number is used as a url parameter to grab certain info from mysql (locations.php?sku= the number ).On first click the page loads in the iframe with no info at all, then if I reload the page by way of the reload button in browser and then click the button a second time, it works. If I change the number and click the button nothing changes until I reload and click the button again. This is the code I'm working with---
Code:
<script type="text/javascript">
url = document.regionbar.sku.value;
function doClick() {[code]......
View 2 Replies
View Related
Jun 8, 2011
I created a bookmarklet script to help me audit extremely large style sheets.Basically while on a site that you would like to audit, you click the bookmarklet and the document's body contents gets remove and replaced with an iframe that points to the current sites home page. From here you can choose what style sheet (the script finds) to begin reporting over. The more pages you browse (through the iframe) the more accurate the report gets.My problem however, is if the person is on the site's home page when first running the script, the iframe never loads up. I think it has to do with the fact that you are on the home page, and then the iframe tries to point to the home page as well and fails for some reason.You can test it by bookmarking this bookmarklet and running it on any site's home page where style sheets can be found:
Get The Bookmarklet on this page (http://tinyurl.com/3gx7fw5)
Again, it works great if you don't start the script from a sites home page.
View 4 Replies
View Related
Aug 2, 2009
<html><head><style type="text/css"><!-- DIV {margin:0px;} --></style></head><body><div style="font-family:arial,helvetica,sans-serif;font-size:12pt">Hello
i'd like to know if it's possible change de message while the page is block by "blockUI" jquery plugin. I've tried a lot of things, but none was good. One thing i've tried was using CSS selectors like:
$('blockUI blockMsg blockPage').innerHTML
but it hasn't worked.
<font size="2"><span style="font-family: verdana,helvetica,sans-serif;"></span></font><div>
[Code].....
View 2 Replies
View Related
Apr 26, 2011
I'm calling $.blockUI() whenever a anchor tag with a "link" class is clicked:
$("a.link").die("click").live("click", function()
{
$.blockUI();
});
The anchor click loads a new page, however, the unblocking of UI doesn't completely work. The overlay is removed, however, the cursor is not changing back to "normal". This is happening in Firefox 3.6.16. So, the end-user perceives the page as still processing because the cursor is "spinning". Moving the mouse will change the "wait" cursor back to the "normal" cursor.
View 3 Replies
View Related
Oct 21, 2009
I have a site that is very jQuery and image heavy. The main sections of the site link to sections that are built with several Tabs, and as it loads, you briefly see all the content load and then it is hidden by the Tabs code.
The plan is to have a full window DIV that sits above all the content with a loading icon that plays until the entire page loads, and then it fades down.
After some hair pulling and research I have code in place that does exactly as I ask, however it does not seem to work in IE6+7. It works in all other browsers.
The current code is:
CSS for the loading DIV is:
A working link is [url]
View 1 Replies
View Related
Aug 11, 2009
i have at the "three"button i've inserted an <iframe>..</iframe>, but it's loaded onlyonce, click on the "one", "two", "three" and again 1,2,3. what seemsto be the problem?i'm using jquery-1.2.6.js
View 1 Replies
View Related
Dec 20, 2011
I am loading an iframe with: $("#framename").attr("src", "uploadsource"); I was wondering if I could hide the framename div and restyle some things like background color and remove images, before making the div visible. I have tried using $(document).ready to reset the background color but the change doesn't take effect:$(document).ready(function() {$("#framename").css("background-color", "white"); }); There are some p tags that I would also like to restyle the font and color of before revealing the div. So, is there a way to change css attributes of an iframe after loading?
View 3 Replies
View Related
Jan 29, 2010
I have a long (more that one screen) document, which has a iframe in the bottom. The iframe target URL contains a "bookmark" (hash mark) to scroll the iframe contents, like this: <iframe src="document.html#bookmark"></iframe> The problem with this is that the main document also scrolls down to show the bookmark in the iframe!
So I tried to solve this with a little jQuery in the main document, but I can't get it to work as it should:
$('iframe').ready(function () {
//alert('hello world');
$(document).scrollTop(0);
});
The alert show that the function is triggered (and having it enabled, actually prevents the document from scrolling down), but the scrollTop() is not executed...
View 2 Replies
View Related
Sep 3, 2009
I am having real problems closing a iFrame after the document in the iFrame has been submitted. I using the prototype library and the following function works great to hide the window when clicking on a close button.
Code:
var docFrames = window.frames[0].document;
docFrames.getElementById('closeFrame').observe('click',function() {
$('frameshadow').hide()
$('photoFrame').hide()
});
The problem comes when I submit the form loaded in the iFrame. This function no longer works. I want to hide the iFrame after the form is submitted, but can't not figure out how.
View 1 Replies
View Related
Dec 23, 2011
I am using tinybox2 to make a modal window, which now I have loading correctly. the modal window loads as an iframe, but I have two image links inside the modal window. One I'd like to open in a new window (i got that one!), the other image I'd like to be treated the same as the X button and have it close the modal window.
this is the body onload in the main document <body onload="TINY.box.show({iframe:'modal.html',boxid:'frameless',width:750,height:450,fixed:false,maskid:'bluema sk',maskopacity:70,closejs:function(){closeJS()}})">
<script language="JavaScript1.2">mmLoadMenus();</script>
[Code].....
View 14 Replies
View Related
Mar 14, 2008
I got this page loading in an iframe, but after a certain time, I want it to stop loading. Meaning, I want to stop the page from loading. The page is in another domain. I don't how much else I can add, if someone needs some extra info
View 4 Replies
View Related
Aug 6, 2003
I need some code that prevents the contents of an iframe from loading outside their source. Namely, the page has its main text content in an iframe so it can be scrolled through while keeping fixed size layouts. That iframe points to a file, content.html, that I want to keep the user from loading directly in the browser. I'd like it so, if they do go to content.html directly, it will just boot them back to the main index.
View 2 Replies
View Related
Oct 10, 2011
I am loading Default2.aspx from MainPage.aspx. i need to display the condense of Default2.aspx in the Div(maincontent) which i declared in Default2.aspx.
with the below code iam getting the DIV object of Default2.aspx from MainPage.aspx.
but the Default2.aspx is not showing ,can any one correct the below code. code...
View 2 Replies
View Related
Jul 20, 2005
Can I fire an event in the host page when a contained IFrame finishes
loading? The page being loaded can come from anywhere (i.e. other sites),
and I need to know how long it takes to load.
View 1 Replies
View Related
Jun 22, 2011
I create an iframe in script and load it with this code.
[Code]...
This should force the loading of the savepages.php file. In that file I do an echo to verify that it is called.
[Code]...
The objective is to call that php function. The javascript function is called. I don't know if the element is actually created. Unlike php javascript doesn't put anything in the source for us to verify. I don't have ajax. How can I make the javascript function call create an element that loads the php file and causes the code in that php file to execute.
View 2 Replies
View Related
Jul 22, 2011
I am having difficulty in opening a link in an Iframe. If I explain, I have four pages
-Page 1 containing the Iframe
-Page 2 containing a series of thumbnails that opens in Iframe on page 1
-Page 3 is the larger image that opens in the Iframe on page 1 after clicking the thumbnail on page 2
-Page 4 is a page with a linking menu that has a link to page 3
The task I am struggling with is to get the link on page 4 to open the larger image of page 3 in the Iframe on page 1. Now I maybe doing something wrong but the code is opening page 2 in the Iframe on page 1. Below are the links to the pages in question.
Page 1 Art for Sale - Bertram Enterprises
Page 2 Bertram Enterprises Collection_Ver2
Page 3 [URL]
Page 4 Jenni Dutton - Bertram Enterprises link near bottom of page - Art for Sale
I wish to use this on many more of the images.
View 7 Replies
View Related
