JQuery :: BlockUI Is Not Changing Cursor Back To Normal After Page Is Loaded?
Apr 26, 2011
I'm calling $.blockUI() whenever a anchor tag with a "link" class is clicked:
$("a.link").die("click").live("click", function()
{
$.blockUI();
});
The anchor click loads a new page, however, the unblocking of UI doesn't completely work. The overlay is removed, however, the cursor is not changing back to "normal". This is happening in Firefox 3.6.16. So, the end-user perceives the page as still processing because the cursor is "spinning". Moving the mouse will change the "wait" cursor back to the "normal" cursor.
View 3 Replies
ADVERTISEMENT
Aug 3, 2009
You should be able to replicate this on http://malsup.com/jquery/block/#pageGo to the page above and click on "Default Message" button and makesure you don't move the mouse cursor.You should see that the cursor remains a hourglass even after the pagecomes back, to get the correct cursor you have to move the mouse.
View 1 Replies
View Related
Sep 24, 2009
I encountered a possible blockUI bug in IE7 and IE8: If you block theui and don't move your mouse after that, the cursor displays thehourglass symbol UNTIL you move your mouse again.Thus, the .unblock() method doesn't have the desired effect on themouse cursor.You can easily reproduce the effect with the blockUI demos: just clickon the "Run" Button without moving your mouse further.
View 9 Replies
View Related
Jun 9, 2011
I have a scripts which filters a list of data based on a users selection from dropdowns in a form. The script updates a counter while the user is making the selections and also colates a url string which I then use to query a php db when the user clicks view results.
I also have a reset button in the form so the user can quickly go back to the start. When this is clicked it does reset all the dropdowns and inputs to their defualt values but it doesn't reset my js functions back to their initial states.
Can anyone tell me how I can do this? Is there a js reset function I can use?
View 1 Replies
View Related
Feb 1, 2011
I noticed a slight usability bug with blockUI. when we block, with a message div - the page is still scrollable. however the message div that comes up, stays where it is, as user scrolls the page. So for example, if the vertical screen resolution is low, the user can not see the bottom of the message div, and in my case the message div has some appept or cancel buttons, which makes my UI unusable?
Are there any workarounds to this solution, other then placing the message div to the top of the page?
View 1 Replies
View Related
May 27, 2009
I've created a carousel widget on [URL].. (under 'Featured Personas' and 'Featured Designers'). Every now and then when the arrow navigation images are clicked, the
mouse returns to the default arrow from a hand. (note: when you are at the end of the carousel, the mouse will change to an arrow). This is not supposed to happen, if I move the cursor away from the navigation arrow and back over, it changes back to a hand as intended. It should stay a hand until the end of the carousel is reached. I've only been able to reproduce it sporadically,
View 2 Replies
View Related
Oct 20, 2011
I'm sure this is simple to solve but I'm a newbie and I'm not sure what to do. I want to use the BlockUI plugin to show "page loading..." while my asp.net page loads some data - takes around 20 seconds. Once the page is fully loaded, I want the message to go away.
View 5 Replies
View Related
Jul 29, 2009
How would you load a separate page in an iframe with BlockUI? I tried: forceIframe:true, iframeSrc:'/iframepage.html' but BlockUI still creates the default "Please wait..." overlay, but also creates a seemingly separate iframe overlay, but without applying any of the CSS properties to it. If BlockUI doesn't have this functionality, so any of the other overlay plugins support it? I've tried jqModal and SimpleModal, but none of them seem to explicitly support this.
View 3 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Aug 2, 2009
<html><head><style type="text/css"><!-- DIV {margin:0px;} --></style></head><body><div style="font-family:arial,helvetica,sans-serif;font-size:12pt">Hello
i'd like to know if it's possible change de message while the page is block by "blockUI" jquery plugin. I've tried a lot of things, but none was good. One thing i've tried was using CSS selectors like:
$('blockUI blockMsg blockPage').innerHTML
but it hasn't worked.
<font size="2"><span style="font-family: verdana,helvetica,sans-serif;"></span></font><div>
[Code].....
View 2 Replies
View Related
Jun 7, 2011
i need typing cursor back in first text box after clicking ok of alert
[CODE]
<html>
<head>
<script type='text/javascript'>
function player()
{
document.getElementById("Player2").value= document.getElementById("Player1").value;
[Code]...
View 2 Replies
View Related
Jun 9, 2011
I have some own cursor with a .cur file. But it's very annoying to try changing each part from the css to the new cursor. Is there no aviable script in JS or HTML or CSS or whatever there is, that i can press the link for all cursor like: Pointer, defaut, wait, stop, link and so on. So they all changes into my own? Without having those white cursor.
View 4 Replies
View Related
Feb 24, 2004
I am trying to write a script that uses the IF statement to see wether or not a user clicked the back button to come to a page, and then if it's true to not let the page load and kick them back X number of pages (say 4) This is what I have so far:
<script language="JavaScript"><!--
if javascript:window.history.back == 1
{
javascript:window.history.back(4);
return false;
}
//--></script>
View 14 Replies
View Related
Jun 9, 2010
I am working on a page that will load in other pages using AJAX and the .html method. Something like this :
<span id = "edit">Edit</span>
<div id = "cont">
</div>
//the click edit script
[Code]....
Unfortunately this does not seem to work, entirely. It does trigger the click event but it messes up the post for some reason. I have played around with it for the last 45 minutes or so and it seems like the click event trigger is what is messing things up, if I comment it out it works fine. Could anyone tell me why they think this is? note this is an over simplified version of my actual code, but the structure is the same.
View 2 Replies
View Related
Oct 11, 2011
I have an onclick that does things and changes the className of my 'logo' div. All of the background images for div id 'logo' are styled by external CSS. A button I setup with addEvent alerts the className of 'logo' correctly but the 'logo' background doesn't change?index.css
Code:
#logo { position:absolute; left:0%; top:0%; width:99.8%; height:24%; background-color:#fdd841;
[code]....
View 10 Replies
View Related
Aug 10, 2011
I'm using a JQuery function to slide a div into and out of visibility, but every time I toggle, the browser resets my view to the top of the web page..What I want to happen is when you click to reveal the div, the page scrolls down and the div content is in full view. When I click again to re-hide the div, I want the page to scroll back up smoothly instead of just reverting to the top of the whole page...The page url is: http:[url]....Here's my code:
Code:
<script type="text/javascript">
jQuery(document).ready(function() {
jQuery(".content").hide();[code]......
View 10 Replies
View Related
Sep 30, 2009
I'm trying to load a page using the .load(url) from an already loaded page, but nothing responds. Below is a simple sample page created to show what I want to accomplish. Also, I'm using JQuery 1.3.
index.html
When the index.html page loads up, the page01.html loads into #mainview. And when I try to click on the <div id="clickme">Click Me!</div> inside page01.html to load page02.html, nothing works. Just can't figure out what's wrong...
View 3 Replies
View Related
Dec 9, 2010
Here is the issue I am having: In my project, I have a index.php page with a sidebar menu and a div id called œcontent.The user can select different menu items and perform searches from the database and make updates to their account. Im using ajax to load all of the menu items and all of the forms into the div id "content" on the index page. The Forms all load into the target div as they are suppose to with ajax.
However, on the mysettings page I have two forms and two different buttons, one called save and the other called update. When a user wants to edit their account information and makes changes to their account they clicks on either button and the form processes the information and updates or inserts data into the database correctly but the problem is that after that the form or page does not display the form back in the div id "content" like how it was loaded originally in the index.php page. The problem is that it reloads or refreshes the form page without the index.php page being involved. That is does not get reloaded or updated inside the index.php page content div again.
What I would like do is have all of my forms process whatever is submitted on the page and display the results back inside the same content div on the index.php page again. I know I am missing something because all of my forms are doing the same thing. I am hoping someone can help me out. I would be very grateful for example code that I can learn from since I am still relatively new to web development. I am posting some sample code below.
[Code]...
View 9 Replies
View Related
Apr 7, 2010
Can jquery animate the way a web page is loaded? for example you may fade in a page or add some effect to it when its loaded. is this possible?
View 1 Replies
View Related
May 15, 2009
how to control loaded page
$("div [id='menuTopLink'][class='menuTopLink4']").click(function () {
$("div [id='mainViewIn'][class='mainViewIn1']").slideUp("slow",function(){
$("div [id='mainViewOut'][class='mainViewOut1']").slideUp("slow");
[code]....
View 2 Replies
View Related
Dec 23, 2010
I'm trying to .show() a div that contains a ...loading... gif before the page is fully loaded. On .ready Im going to hide it code...
View 2 Replies
View Related
May 4, 2010
i have the following code
<script type="text/javaScript">
$(document).ready(function(){
$("#dropPrd").change(function() {
$('#imgAjaxLoading').ajaxStart(function(){
[Code].....
and i want to access the element dropSubPrd that is inserted on that ajax function, on the div FirstResult, but it will not work in $('document').ready because when the page load's that element isnt there.
View 1 Replies
View Related
Apr 23, 2009
For example I have a page: [URL] On this page I use $.ajax:
$.ajax({
type: "GET",
data: "data=123456",
dataType: 'html',
[Code].....
where temp.php - [URL] On temp.php I use requests for DB with param from $.ajax - data=123456. How I can protect page temp.php? For example, somebody typing [URL] and then he can get all results. I found one solution - using if($_SERVER['HTTP_REFERER'] == "http:// mysite.com/content/") {....} But Am not shure that it can realy protect my page?
View 2 Replies
View Related
Jul 23, 2009
I am trying use the Load function and it looks partly succesful:the script code is:
function doCallBack(action, value)
{
if (action == 'projlokatiemutaties')
[code]....
Projectlokaties1 contains an XML control and the content is being transformed using Xslt. As far as I can see the html variable contains
the correct value. However the Response.Write() operations fails completely. As a matter of fact at this point any Response operation fails.
View 1 Replies
View Related
Jan 13, 2012
I am trying to use JQuery to submit a form without reloading the page. Although this works well with thejQuery Form Plugin on a standalone page I need it to work on a page I've loaded with AJAX.[code]...
View 2 Replies
View Related
May 18, 2011
We use WebSphere 6.1 as web server and the project is in ear file. After deployment, sometimes access server, the page was load incomplete, such as logo image (.gif) disappeared, and JavaScript error appeared. But after press on Refresh button from browser (IE), the page is loaded completed, all images are loaded and the JavaScript is gone.
[Code]...
We have tried to optimize the JSP page, however the page loaded is faster but this issue still occurred once in a while. Does anyone encounter the same issue before?
View 2 Replies
View Related