JQuery :: Change Message While The Page Is Blocked Using BlockUI Plugin
Aug 2, 2009
<html><head><style type="text/css"><!-- DIV {margin:0px;} --></style></head><body><div style="font-family:arial,helvetica,sans-serif;font-size:12pt">Hello
i'd like to know if it's possible change de message while the page is block by "blockUI" jquery plugin. I've tried a lot of things, but none was good. One thing i've tried was using CSS selectors like:
$('blockUI blockMsg blockPage').innerHTML
but it hasn't worked.
<font size="2"><span style="font-family: verdana,helvetica,sans-serif;"></span></font><div>
[Code].....
View 2 Replies
ADVERTISEMENT
Jan 6, 2010
in this plug-in I need a function like onUnblock but on completedfadein..
View 1 Replies
View Related
Aug 20, 2009
I'm calling blockUI and then running ajaxForm on my whole page form. BlockUI is firing an overlay (with form field content) but only after the form has been ajaxed. Because of this my fields aren't seen as in the form and so subsequent form submits fail. Firebug says: form is null, /assets/js/jquery.form.js, Line 364 (form.clk = this;) The longer version:The javascript for these events are being returned to taconite within<eval> blocks. They are coming back in the below order: blockUI on whole page I then call a custom function which contains the "$('#page- form').ajaxForm({ dataType: 'xml' })"; When I alert inside that custom function it occurs before any blockui overlay is shown. I'm surmising that this is breaking the form submit for elements within the blockui message (which are actually already on page but hidden).
I've tried adding alerts before and after blockui is called and they run in the correct order so I'm guessing that perhaps blockui queues itself to run somehow. BlockUI doesn't have any after block callbacks that I'm aware of. I'm wondering if I can add a beforeSubmit callback to the ajaxForm method that calls itself to update the form but that just feels a bit dirty. I use the framework that I've put together extensively and it's only when adding blockui that I have this issue so I'm (at least fairly) sure that it's not a PEBKAC issue.
View 1 Replies
View Related
Aug 21, 2009
I'm trying to implement the Growl option for the blockUI plugin, the "hard" way ( as seen here: http:[url].... second to last example). The reason why I'm going the "hard" way is because I'd like to have multiple Growl messages - one for an error,one for a success, etc, all of which have different background images / styles (ex: a red X for error, a green checkmark for a success).The "easy" growl method, while allowing for different text content,only allows for one style. Thus I'm trying to get around this limitation using the "hard" way:
$.blockUI({
message: $('div.growlUI'),
fadeIn: 700, [code]...
subsequently adding different styles in my stylesheet. Yet I get an error that says "data.parent = node.parentNode", when I try and run the above code. Has anyone had any luck getting *different* growl messages with different styles/images in them to run on the same page?
View 1 Replies
View Related
Feb 1, 2011
I noticed a slight usability bug with blockUI. when we block, with a message div - the page is still scrollable. however the message div that comes up, stays where it is, as user scrolls the page. So for example, if the vertical screen resolution is low, the user can not see the bottom of the message div, and in my case the message div has some appept or cancel buttons, which makes my UI unusable?
Are there any workarounds to this solution, other then placing the message div to the top of the page?
View 1 Replies
View Related
Oct 20, 2011
I'm sure this is simple to solve but I'm a newbie and I'm not sure what to do. I want to use the BlockUI plugin to show "page loading..." while my asp.net page loads some data - takes around 20 seconds. Once the page is fully loaded, I want the message to go away.
View 5 Replies
View Related
Apr 1, 2009
How can I show a popup that is not blocked and then redirect the user to a page?
View 1 Replies
View Related
Jul 29, 2009
How would you load a separate page in an iframe with BlockUI? I tried: forceIframe:true, iframeSrc:'/iframepage.html' but BlockUI still creates the default "Please wait..." overlay, but also creates a seemingly separate iframe overlay, but without applying any of the CSS properties to it. If BlockUI doesn't have this functionality, so any of the other overlay plugins support it? I've tried jqModal and SimpleModal, but none of them seem to explicitly support this.
View 3 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Apr 26, 2011
I'm calling $.blockUI() whenever a anchor tag with a "link" class is clicked:
$("a.link").die("click").live("click", function()
{
$.blockUI();
});
The anchor click loads a new page, however, the unblocking of UI doesn't completely work. The overlay is removed, however, the cursor is not changing back to "normal". This is happening in Firefox 3.6.16. So, the end-user perceives the page as still processing because the cursor is "spinning". Moving the mouse will change the "wait" cursor back to the "normal" cursor.
View 3 Replies
View Related
May 18, 2010
I've written my own custom validation method using addMethod which works great. But what I'd like to do is change the error message depending on which part of the validation it fails on.
I've tried defining & using a var for the message but the message never changes, a very simple cut-down example:
var customError = "";
$.validator.addMethod("myvalidator", function(value, element) {
[Code]....
View 4 Replies
View Related
Dec 16, 2011
This plugin enforces max length on text areas and reports back the number of characters left to use.How would I add commas to the feedback message that says how many characters are left?
View 5 Replies
View Related
Nov 16, 2010
I am using JQuery Validate Plugin and it working perfectly but the problem is for error place when error message come it make my form display look bad due to error.
I will explain you howThis is my screen when the page is load
Now when I press the Add New Company Button
You can see that look is getting bad. What is the solution for this. how can I stop this.
I am using DIV for each label and text.
View 4 Replies
View Related
Apr 2, 2011
I am calling a custom method to validate adate input element (this element is an array ). Upon validation, a message is displayed against each date input element, even if the others are valid. If one date element is invalid, all other valid date elements too show the message. How do I make sure that the error message is displayed only for the invalid element?
My formelement is defined as such:
<input name="order_date[ ]" size="10" type="text">
Here's the script:
<script type="text/javascript">
[Code]....
View 1 Replies
View Related
Jul 16, 2009
I want to display a promotional message when the user clicks the submit button and before it goes to the server. The user must meet certain criteria in order to do this which is their postcode and I have written a regex for this -
/[TA]{2}[1-18|22|24]{2}/ I'm not sure how to incorporate this into my script. I have this so far.
[Code]...
View 3 Replies
View Related
May 24, 2010
I tried assigning 2 error classes to an error message (as a span), but when the empty field was fixed, the error message wouldn't disappear.
$
(
"#testForm"
)
.
[Code]....
With 1 error class it works fine, but adding a second one makes it fail. Here are some links, just hit the submit button a few times on each one to see what I mean
2 classes: [URL]
1 class: [URL]
View 5 Replies
View Related
May 17, 2011
Is there a way to force Fancybox to re-size after the Validation plugin returns an error message?
I have been trying to insert this into the process, but I cannot seem to get it work.
$.fancybox.resize;
View 1 Replies
View Related
May 7, 2009
Is there a way to make the area that isn't being blocked grayed out?
Ideally, it would just be opaque, so that it is obvious that the only area that can have interaction is the element being blocked.
View 1 Replies
View Related
Dec 4, 2010
I've been trying to implement a smooth scrolling animation in my page, which works fine in firefox and IE8 (haven't tested any older versions yet). But doesn't seem to work in google chrome (and probably safari either I guess). I have 4 divs on my page, positioned absolutely 2 by 2, only one div should be visible at a time, so the body has gotten an overflow:hidden. When an anchor-link to one of those divs is clicked the javascript gets its position,then scrolls towards it. etting the position works, but the scrolling does not work in chrome.
Now, when I remove 'overflow: hidden' from the body element, the scrolling does work in chrome, but of course adds the scrollbars which I don't want.
[Code]...
View 1 Replies
View Related
Sep 10, 2009
Javascripts that I find on the net sometimes have pop up messages as part of the app / game, Id like to change the colors used in these pop ups, also Id like to get rid of the blue top bar we have in the pop up.I don't like the top blue bar with the message - Quote ... The page at http://javascript.internet.com s... I want to get rid of that top bar.If I cant get rid of it, at least change the color of it, so make it black, the writing on it black red cross icon, all black.Id also like to change the cream background in the message as well and give it my own color.Really I just want the you did it message, with the time read out the game works out and the OK Button.What can I do, I just don't like the look of pop ups in java apps, I want to change how they look, or even 'replace' with something else. What can we do?Here is the original game on the web site I found it
http:[url]......And here is the code.
Quote ... <HEAD>
<SCRIPT LANGUAGE="JavaScript">
<!-- Original: Brian Gosselin (bgaudiodr@aol.com) -->
<!-- Web Site: http://www.bgaudiodr.iwarp.com -->[code]......
View 1 Replies
View Related
Mar 2, 2010
Is it possible to "Only" display a loading message and hide all page's elements and graphics until the page is fully loaded. then loading message disappear and the content fades in!?[code]...
View 4 Replies
View Related
Oct 9, 2009
I am using jQuery and BlockUI to display a "Loading..." message to theuser while the page is loading.The problem is that the "Loading..." message seems to show up AFTERthe page has loaded, not during load. Shouldn't the document.readyfire sooner than that?What am I doing wrong?
<script>
$(document).ready(function() {
$.blockUI();
[code]....
View 18 Replies
View Related
Jul 9, 2010
I made a webpage that finds factors of numbers (I know, how exciting [YAWN]). But if you enter a number too large the internet web page crashes and a message appears:
Quote:
Stop running this script?
A script on this page is causing Internet Explorer to run slowly. If it continues, your computer might become unresponsive.
I would much rather my own personalised message to appear instead because that message may seem a bit 'frightening' to someone and might immediately clicked yes - do stop running the scripts
I tried using a 'try and catch' statement but couldn't incorporate it.
My Code is as follows (although you may not even have to read any of it if you know a solution):
Code:
function FindFactors(Input, Maximum){
Input2 = Input
while(Input2 <= Maximum){
[Code]....
Is it even possible to do what I am trying to do. Also, I imagine other web browsers have a similar system to IE - they stopping running scripts when it becomes to much to handle, but I don't have to worry about that for now.
View 3 Replies
View Related
Oct 12, 2006
Is it possible to create a popup that won't be blocked?
View 2 Replies
View Related
Oct 17, 2005
I'm trying to use window.open in some buttons on a website I'm building. The windows open in all browsers that I've tested except IE (PC and Mac). I'm assuming this is a pop-up blocker issue even though what I've read says that if the user initiates the pop-up, then it will work even with the blockers enabled.
Does anyone know how to fix this without using target=_blank?
The site is www.cascadequilting.com. The code for the pop-up windows is below:
<a href="#" window','height=600,width=800,status,scrollbars,resizable')">Click here for a quilt size chart.</a>
View 5 Replies
View Related
Jul 7, 2009
i faced a problem in java script which is when i want to prompt a message box and enable to let user to type their own password. but i found that a problem is when the user type their own password in the prompt box's text box, the text box's text mode is normal but not password mode. So to prevent more security and don't allow other people see the password when typing, what should i do? or have other ways to let me finish this task?
View 1 Replies
View Related
