I have seen some posts similar to this, but don't think I've seen any resolutions; other than perhaps it cannot be done. Have a set of html files (each one a segment of a page -- not full with a head, etc.). Am using jQuery ajax on a click event to load appropariate html file into a holding div.I've used the $('#gpsDetArea').load method as well as the ajax method:
[Code]...
$(document).ready(function() {
$('#main-content a').live('click', function() {
alert(this);
$('#main-content').load(this);
return false;
});});
Why is the above code segment not loading the page? When I replace this by an url it works correctly. The alert gives a correct url.
I tried to load 1 html through ajax and javascript and it worked.But i want to load more than one and i cant.I thought that it would be a good idea to put the ajax files to the external websites and put the same load button.I tried this idea but it doesn work.I can only load one external website.
View 2 Replies View RelatedI have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
Something is up with my coding, when I try to load the page.. it will only load in notepad.
<html>
<head>
<title>Other ways to help</title>
<SCRIPT TYPE="text/javascript">
[Code].....
I have a site that is very jQuery and image heavy. The main sections of the site link to sections that are built with several Tabs, and as it loads, you briefly see all the content load and then it is hidden by the Tabs code.
The plan is to have a full window DIV that sits above all the content with a loading icon that plays until the entire page loads, and then it fades down.
After some hair pulling and research I have code in place that does exactly as I ask, however it does not seem to work in IE6+7. It works in all other browsers.
The current code is:
CSS for the loading DIV is:
A working link is [url]
I have a jQuery script that loads and displays a small window on a mouse hover. I use jQuery AJAX to load the content on that window. Having that, I noticed that loading the response from php file (which does not have a php code, only the file has .php on its name) is slower than the same file content with .html name. I wonder if this is a common problem or there is some issue with my codes. I will post my code if needed (if that seems to be the problem).Note: I mentioned that there is no php code in the php file because I am only testing the performance currently. After it is developed, there will be (obviously) php code in it.
View 2 Replies View RelatedI have a lot of javascript functions that request information from an iframe hidden on the page. I see other sites do this, but their browser does not do the loading action (like the processing circle in Firefox). When I do it on my site, each browser shows the loading icon, as if a page was loading. Is it possible to not have this?
http://bit.ly/cv1YqN
That is a sample link. Go down right side of page where you see three buttons: Trailers Featurettes Clips.Those return iframe information to work.
I have a login button which takes the user to the login page. Now... this to me seems like a slow way of logging in. I would like users who have javascript enabled to click the login button. Instead of them being forwarded to the login page, I want the login form to magically pop up on top of the web page.
I can do this, I can creative a div, add the html and probably with a bit of trying - get the user to login. However I have a question. For maintainability, I want to have create a separate HTML file, how would I insert this into my page using Javascript?
Furthermore speed is crucial, is there a way to have this fragment load in the background on every page? I am not sure what would be best, i just don't want a second or two wait when the button is pressed. Basically - in short - how to I load this file fragment? What is the fastest way to do this?
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
showNewContent();
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top? Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
I am trying to load a div from one page, into a div on another page. On the webpage I am loading the new div to I put:
[Code]...
Why doesn't this work right? It looks right to me... what am i missing??
I'm fairly new to jquery so apologies if this is a very simple question with a very simple answer, but I just can't figure out the solution. I have an overlay div, and when I close the overlay I want to remove the html inside it and then re-load it from the specified file. I have already worked out how to empty the div, but what I now want to do is re-populate it with the content from a separate file on my web server.
[Code]...
i want to make a iframe page that loading a page from other site. I have try "jQuery iFrame Sizing" to set auto height in iframe... but it is failed.
This is my code :
-------------
on Head
<script type="text/javascript" src="js/jquery.js"></script>
<script type="text/javascript" src="js/iframe.js"></script>
on Body
[Code]....
here we have my new site
[URL]
If you look good the source of this page, i have some .aspx load to .ajob div when i click image links...
here the piece of :
<div
class
="thumbnailMask"
> <ul
[Code].....
.aspx appears in this too :
[URL]
i want replace .aspx by xhtml or html in the same place then there
I am loading an entire page in ajax, but I just want to load a fragment from it. Using the .load() function, you can do this by adding a selector after your url like 'getPage.php #myDiv' etc, how to do it using the .ajax method.
I did some googling and found this solution:
$.ajax({
url: 'AjaxTest2.htm',
data: {},
cache: false,
[Code].....
I'm trying to get the "d1" div to be populated with the contents of the "my2" div on the second page. I don't want to use the .load() function, I want to use the .ajax() function. I can get this to work if I just use: $('#d1').html(data); instead of $('#d1').html($(data).find('#my2')); but the former results in the entire html contents of the second page being placed into the "d1" div, and I only want the fragement.
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
I am loading Default2.aspx from MainPage.aspx. i need to display the condense of Default2.aspx in the Div(maincontent) which i declared in Default2.aspx.
with the below code iam getting the DIV object of Default2.aspx from MainPage.aspx.
but the Default2.aspx is not showing ,can any one correct the below code. code...
I have created a party-events website. Which displays a lot of dates of events. As you might understand this page takes some time to load. Therefor I want some of loading image to be displayed while the page is loading. Anybody has an idea how to pull this of? I don't know how.
In detail: People come to my website. They click on "events" and a loading.gif pops up and and makes the background darker. After the page has completely loaded the loading image disappears and the website shows.
I need to have a simple text input field on a html page. It needs the users to type in either:
And depending on whats entered this will then take them to the corresponding:
Is this possible with javascript?
I came up with some code to load javascript files dynamically. But I've got problems..
When the script element is dynamically added to the head section of html, i think that the document.ready event fires once again and therefore the code sort of runs twice.
In the html page I call this method:
In the script test.js I have the function SayHi():
The SayHi method never gets called and alert('begin') & alert('getScript') get called twice in this sequence:begin begin getScript getScript.
I am messing around with the jPaginate files, essentially a pagination script using jQuery. I have the mark up working, but I am just messing around (not a real expert in JavaScript) and I have a simple question. When the user clicks on the next page icon, the next page does indeed load. However I would like the page to load and for the browser to scroll back to the top of the new page. Is there a way to do this in HTML / Javascript?
just wanted to see if there are ways to do this, I have code if anyone needs to see that but I think my problem exists purely because of my lack of understanding of some web design tricks.
On the following page:[URL]I would like to load in content from an xml file, when the user clicks on one of the products from the sidemenu. The content will be an image and text for each type of headphone. I've been looking into it and I thought the best way would be to have 1 XML with all the content for each type instead of having one XML or one HTML for each type.
Code:
$(document).ready(function() {
$('#letter-d a').click(function() {
$.get('d.xml', function(data) {
[code]..
Like title says, I'm looking "Loading page" -notice when page is loading - made by Javascript. If you know Cross-browser/multi-browser example
View 1 Replies View RelatedI have this normal HTML page, starts with <!DOCTYPE ...... and end with </html>, nothing special, what I need is to get every character from the beginning to the end.I've tried $("html").html(), but this cannot get the <!DOCTYPE line and also the <html> line, but only the codes inside the <html> tag, how can I get all ?
View 1 Replies View RelatedI am loading a page with several jquery events on one of the divs. Depending on interaction with the user, the div triggering the jquery events could be reloaded from an ajax call. But as it stands now, new content that is added to the dom is not triggering the code in the original $(document).ready() supplied in the head. If I want the page to set up those events again, I have to reimport the js file containing my jquery events (this causes to copies to exist in the dom. Is there a way to force the existing jquery scripts to rebuild its event stack based on the new dom content? I was thinking something like:
$(document).rebindDom()
I was optemizing my site with yslow, and it stated that i had too many http requests, so i told php to include select js files and readfile them into the page and then get gzip'd.
[Code]...