here we have my new site
[URL]
If you look good the source of this page, i have some .aspx load to .ajob div when i click image links...
here the piece of :
<div
class
="thumbnailMask"
> <ul
[Code].....
.aspx appears in this too :
[URL]
i want replace .aspx by xhtml or html in the same place then there
I can obviously load an aspx page into a div container thru .load jquery function. But, if the aspx page is already enginereed to work with aspnet ajax (scriptmanager,etc) , this is lost and the first postback cause all the page to reload. My question is, how can I import an aspx page into a div, maintaining its own ajax functions ? In case it's not possible, what's the best way to get same result?
View 2 Replies View RelatedI have a html document with some jquery which is working fine...i pasted the same code in aspx page but its not working properly...i am not able to make out where the problem lies...
View 3 Replies View RelatedWhy my script is working in an HTML 4.0 doc but not in XHTML. When I have it in XHTML and click the reset button it does reset the form but not the table. If I have it in HTML doc it resets both the table and the form.
Here is my code for the form (the part that is affected by the reset.)
This is for a class and they are requiring it to be XHTML..
You can see the it here: [url]
HTML Code:
This is the actual button
HTML Code:
And here is the script
Code:
I have a html document when i run in Internet explorer i am getting the desired output(j query working fine). But i copy pasted the same code in aspx page...the same code is not working properly...
View 9 Replies View RelatedI want to replace all text in the html that contains the word "Hello" to "Hi" (quotes not included and not case-sensitive). Here's what I've made:
if ($('body:contains("Hello")').length > 0) {
$("*").each(function () {
$('body').html($('body').html().replace('Hello','Hi'));
});}
Without the:
$("*").each(function () {
It only searches for the first word so I added the line above to search within all elements (If this is correct). But the problem is, I notice that the line I added seems to cause the page to run slower than usual. Is there any other way to do this?
i wan't replace an link (< a target=... ) which is in an "<td class="ms-vb-icon">" . My html example is below.
[Code]...
Can method replaceWith() be used to replace just ONE WORD in body of a tag (i.e., element.html()?) with another word? I have li's with "tab one", "tab two", "tab three" etc.. I have to replace dynamically ONLY the word "tab" with another word..
View 2 Replies View RelatedI have
<ul id="some_id">
<li><a href="#"><span>some text || some text1</span></a></li>
</ul>
[Code]....
I want to replace a part of a link. See my example below.
The Links :
1)
href="/businessapplications/iop/weschein/Lists/Receipts/EditForm.aspx
?ID=219"
2)
href="/businessapplications/iop/weschein/Lists/Receipts/EditForm.aspx
?ID=220"
[Code].....
I tried to load 1 html through ajax and javascript and it worked.But i want to load more than one and i cant.I thought that it would be a good idea to put the ajax files to the external websites and put the same load button.I tried this idea but it doesn work.I can only load one external website.
View 2 Replies View RelatedI have a jQuery script that loads and displays a small window on a mouse hover. I use jQuery AJAX to load the content on that window. Having that, I noticed that loading the response from php file (which does not have a php code, only the file has .php on its name) is slower than the same file content with .html name. I wonder if this is a common problem or there is some issue with my codes. I will post my code if needed (if that seems to be the problem).Note: I mentioned that there is no php code in the php file because I am only testing the performance currently. After it is developed, there will be (obviously) php code in it.
View 2 Replies View RelatedI have page with an Ajax request which returns an entire <hml>..</html> page and I would like to use this response data to replace the current page. I wrote the following :
$.ajax({
type: "POST",
url: URL,
data: formData,
[Code]....
I've seen an other post talking about not being able to perform a .html().replace() also, but no one replied.
[URL]
Why is this? I ran into the same problem and from what I was seeing, the replace() was only replacing the very first match. My work around was pretty simple, I just keep running replace() until it was done, but I'm dumbfounded as to why this would need to be done.
while (newLastRow.html().indexOf(settings.placeholder) > -1){
newLastRow.html(newLastRow.html().replace(settings.placeholder, curTotal)); }
As with the other post, I'm dynamically adding html to the page using a template, where the replace() method is updating the IDs of the fields when adding a new instance.
What's special about the value returned by the html() method? Is there a different preferred way to do this?
I have a login button which takes the user to the login page. Now... this to me seems like a slow way of logging in. I would like users who have javascript enabled to click the login button. Instead of them being forwarded to the login page, I want the login form to magically pop up on top of the web page.
I can do this, I can creative a div, add the html and probably with a bit of trying - get the user to login. However I have a question. For maintainability, I want to have create a separate HTML file, how would I insert this into my page using Javascript?
Furthermore speed is crucial, is there a way to have this fragment load in the background on every page? I am not sure what would be best, i just don't want a second or two wait when the button is pressed. Basically - in short - how to I load this file fragment? What is the fastest way to do this?
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
showNewContent();
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top? Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
I am trying to load a div from one page, into a div on another page. On the webpage I am loading the new div to I put:
[Code]...
Why doesn't this work right? It looks right to me... what am i missing??
I'm fairly new to jquery so apologies if this is a very simple question with a very simple answer, but I just can't figure out the solution. I have an overlay div, and when I close the overlay I want to remove the html inside it and then re-load it from the specified file. I have already worked out how to empty the div, but what I now want to do is re-populate it with the content from a separate file on my web server.
[Code]...
I have seen some posts similar to this, but don't think I've seen any resolutions; other than perhaps it cannot be done. Have a set of html files (each one a segment of a page -- not full with a head, etc.). Am using jQuery ajax on a click event to load appropariate html file into a holding div.I've used the $('#gpsDetArea').load method as well as the ajax method:
[Code]...
I'm using
<link href="../css/le-frog/jquery-ui-1.8.16.custom.css" rel="stylesheet" type="text/css" />
<script src="../js/jquery-1.7.1.min.js" type="text/javascript"></script>
<script src="../js/jquery-ui-1.8.16.custom.min.js" type="text/javascript"></script>
[Code].....
Like that, my aspx button inside the dialog (inside the div) doesn't work... it doesn't do a post back. I click and nothing happens (no JS errors). If I comment out the line $("#dialogProd").dialog({ width: '400', position: 'right' });
Then it works normaly as expected (obviously the dialog doesn't show, and I see the DIV as a regular div).
Is there anytihing wrong with the code? some way to prevent this? I had the same code in older version of jQuery and did not have a problem.
Can the UI dialog be used for this?
View 1 Replies View RelatedI'm new to using JQuery and I've been searching everywhere to be able to post XML to a WebMethod on an aspx page in a site. I'm sure it can be done but I just have no idea how.
View 2 Replies View RelatedI have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
I am loading an entire page in ajax, but I just want to load a fragment from it. Using the .load() function, you can do this by adding a selector after your url like 'getPage.php #myDiv' etc, how to do it using the .ajax method.
I did some googling and found this solution:
$.ajax({
url: 'AjaxTest2.htm',
data: {},
cache: false,
[Code].....
I'm trying to get the "d1" div to be populated with the contents of the "my2" div on the second page. I don't want to use the .load() function, I want to use the .ajax() function. I can get this to work if I just use: $('#d1').html(data); instead of $('#d1').html($(data).find('#my2')); but the former results in the entire html contents of the second page being placed into the "d1" div, and I only want the fragement.
I have the following Javascript code to write a code to the page using InnerHTML. But instead of writing the code, it shows the content of the iframe. How can I make the code write straight text of the HTML code...
View 1 Replies View RelatedPossible Duplicate: Replace words in a string, but ignore HTML Is it possible to ignore the HTML elements when calling Replace?
Sample code:
$myText.replace(new RegExp( $searchString, 'gi' ),
'<span class="highlight">'+ $searchString + '</span>');
$myText is a large string of HTML e.g.:
var $myText =
[Code]...