JQuery :: Loading A HTML Fragment?
Feb 7, 2010
I have a login button which takes the user to the login page. Now... this to me seems like a slow way of logging in. I would like users who have javascript enabled to click the login button. Instead of them being forwarded to the login page, I want the login form to magically pop up on top of the web page.
I can do this, I can creative a div, add the html and probably with a bit of trying - get the user to login. However I have a question. For maintainability, I want to have create a separate HTML file, how would I insert this into my page using Javascript?
Furthermore speed is crucial, is there a way to have this fragment load in the background on every page? I am not sure what would be best, i just don't want a second or two wait when the button is pressed. Basically - in short - how to I load this file fragment? What is the fastest way to do this?
View 3 Replies
ADVERTISEMENT
Feb 13, 2011
I am loading an entire page in ajax, but I just want to load a fragment from it. Using the .load() function, you can do this by adding a selector after your url like 'getPage.php #myDiv' etc, how to do it using the .ajax method.
I did some googling and found this solution:
$.ajax({
url: 'AjaxTest2.htm',
data: {},
cache: false,
[Code].....
I'm trying to get the "d1" div to be populated with the contents of the "my2" div on the second page. I don't want to use the .load() function, I want to use the .ajax() function. I can get this to work if I just use: $('#d1').html(data); instead of $('#d1').html($(data).find('#my2')); but the former results in the entire html contents of the second page being placed into the "d1" div, and I only want the fragement.
View 6 Replies
View Related
Jan 5, 2012
A REALLY simple example, surprising to me this doesn't work...
This is my php code:
And here the html from which the php-script is called:
Here's supposed to be the output: <div class="output" id="output">test</div>
The text "test" inside the div gets replaced by nothing. and if i use the line i commented out instead of " $('.output').html(data)", i get the following output: "[object XMLDocument]"
Btw really susprised to see a forum on a website like this without proper code-tags with monospaced font...
View 16 Replies
View Related
Oct 19, 2010
<html>
<head>
<script type='text/javascript' src='jquery-1.4.2.js'></script>
<script type='text/javascript'>
$(document).ready(function(){
[Code]...
The above is a simplified example of the problem I'm facing. I could merge functions into one big self-referencing function (i.e. recursive function), but that's ugly and causes other problems (such as when insert form elements and wanting to harvest the user input afterwards). I considered declaring a variable in the top ".ready" function, and have all child functions stuff their HTML changes in it, but that seems to be a pain to keep track of and removes much of the value of using jQuery in the first place...
Is there a nice solution for this? To, after inserting HTML, somehow update the HTML state referred to by jQuery in the non-local scope(s)?
View 3 Replies
View Related
Apr 14, 2011
I tried this code in [URL]... jquery reports as 4 elements in firefox/chrome browsers correctly where as 0 in internet explorer 6.0 How do i fix this? Should I report this as bug?
View 1 Replies
View Related
Jan 29, 2009
I'm trying to embed an HTML fragment from one web page into another web page, using AJAX (as the fragment will change frequently). I'm using prototype.js for AJAX.
I've managed to fetch the HTML content of the slave page, but I can't figure out how to get just the part I want from the XML string returned in the AJAX request. The prototype.js AJAX function just returns a text sttring that I need to parse...but how?
Child Page: hello.html
Code HTML4Strict:
I want to include the <h1>Hello</h1> in the parent page.
Parent page: demo.html
Code JavaScript:
Obviously it's the fragment = resultDoc.getElementByClassName( source_fragment_name ); part that I'm having difficulty... It may not even be the right function - HELP.
The resultDoc=parser.parseFromString(transport.responseText,"text/xml"); seems to work, because the subsequent alert() works fine, but how do I get the page fragment identified by the source_fragment_name.
The alert("Fragment = " + fragment ); never happens, so the previous line has serious problem.
So, just to clarify, I simply want to parse the content out of one page, and embed it into another, in real-time, using AJAX.
View 4 Replies
View Related
Dec 10, 2010
Is there a way to load more than one html fragment using .load()? That is, I want my homepage to pull in multiple pages of content into the main page so that I can create a one-page site that slides vertically.
An example of what I've got is
$(document).ready(function(){
$('#footer').load('about.html #content');
$('#footer').load('locations.html #content');
$('#footer').load('contact.html #content');
});
Which of course only loads the first about.html page's #content into the #footer of the home page.
View 3 Replies
View Related
Jun 8, 2010
Impatience got the better of me. For the fragment method using .load(), how can I load more than one fragment?
View 1 Replies
View Related
Jan 23, 2011
I'm using href fragments to 'jump' down the page. The links have a fixed position so they stay visible.
How can I highlight the active link? So when you click link2 and you jump to the blue section, how can I highlight the link2 text?
View 3 Replies
View Related
Dec 28, 2010
I tried to load 1 html through ajax and javascript and it worked.But i want to load more than one and i cant.I thought that it would be a good idea to put the ajax files to the external websites and put the same load button.I tried this idea but it doesn work.I can only load one external website.
View 2 Replies
View Related
Dec 2, 2011
I have a jQuery script that loads and displays a small window on a mouse hover. I use jQuery AJAX to load the content on that window. Having that, I noticed that loading the response from php file (which does not have a php code, only the file has .php on its name) is slower than the same file content with .html name. I wonder if this is a common problem or there is some issue with my codes. I will post my code if needed (if that seems to be the problem).Note: I mentioned that there is no php code in the php file because I am only testing the performance currently. After it is developed, there will be (obviously) php code in it.
View 2 Replies
View Related
Oct 15, 2009
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
showNewContent();
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top? Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
View 3 Replies
View Related
Jan 30, 2011
I am trying to load a div from one page, into a div on another page. On the webpage I am loading the new div to I put:
[Code]...
Why doesn't this work right? It looks right to me... what am i missing??
View 2 Replies
View Related
Mar 17, 2011
I'm fairly new to jquery so apologies if this is a very simple question with a very simple answer, but I just can't figure out the solution. I have an overlay div, and when I close the overlay I want to remove the html inside it and then re-load it from the specified file. I have already worked out how to empty the div, but what I now want to do is re-populate it with the content from a separate file on my web server.
[Code]...
View 1 Replies
View Related
Feb 9, 2011
I have seen some posts similar to this, but don't think I've seen any resolutions; other than perhaps it cannot be done. Have a set of html files (each one a segment of a page -- not full with a head, etc.). Am using jQuery ajax on a click event to load appropariate html file into a holding div.I've used the $('#gpsDetArea').load method as well as the ajax method:
[Code]...
View 16 Replies
View Related
Aug 23, 2011
here we have my new site
[URL]
If you look good the source of this page, i have some .aspx load to .ajob div when i click image links...
here the piece of :
<div
class
="thumbnailMask"
> <ul
[Code].....
.aspx appears in this too :
[URL]
i want replace .aspx by xhtml or html in the same place then there
View 3 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Mar 16, 2010
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
View 5 Replies
View Related
Feb 6, 2010
I came up with some code to load javascript files dynamically. But I've got problems..
When the script element is dynamically added to the head section of html, i think that the document.ready event fires once again and therefore the code sort of runs twice.
In the html page I call this method:
In the script test.js I have the function SayHi():
The SayHi method never gets called and alert('begin') & alert('getScript') get called twice in this sequence:begin begin getScript getScript.
View 1 Replies
View Related
Feb 3, 2010
On the following page:[URL]I would like to load in content from an xml file, when the user clicks on one of the products from the sidemenu. The content will be an image and text for each type of headphone. I've been looking into it and I thought the best way would be to have 1 XML with all the content for each type instead of having one XML or one HTML for each type.
Code:
$(document).ready(function() {
$('#letter-d a').click(function() {
$.get('d.xml', function(data) {
[code]..
View 2 Replies
View Related
Sep 8, 2009
I'm currently working on my portfolio website and would like to have information about my movie clips be retrieved from an XML document when a thumbnail is clicked. I am building my website in HTML and would like to retrieve the Xml using JavaScript.
[Code]...
View 1 Replies
View Related
Oct 15, 2009
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
Code:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top?
Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
View 1 Replies
View Related
May 15, 2010
Something is up with my coding, when I try to load the page.. it will only load in notepad.
<html>
<head>
<title>Other ways to help</title>
<SCRIPT TYPE="text/javascript">
[Code].....
View 1 Replies
View Related
Jul 23, 2005
I need to delay something either an image or a table from loading for 2-5
seconds. So far I have not find a good method.
I need the rest of the page, even the codes after the delayed image, to be
displayed in real time.
View 5 Replies
View Related
Jul 29, 2009
I am trying to do the following without html frames.
-Let's say i a html file which contains the structure of a calendar (table, rows, cells, etc)
-Have javascript load the contents of the html file into the page without frames and without disturbing the previous content.
So the advantage is that i would not have to use javascript to create the structure of the calendar but instead to load it so that javascript only have to fill the contents of the calendar.
View 9 Replies
View Related
Mar 28, 2009
i found a way to click a link and load it into a div. the only problem is that i keep getting the "AHA error" from the if statement in my div.
i'm not sure if it is me or the coding but i'll post what i'm using in jscript here:
function ahah(url, target) {
document.getElementById(target).innerHTML = ' Fetching data...';
if (window.XMLHttpRequest) {
req = new XMLHttpRequest();
[Code]....
i don't think it's because i'm using an image map (i know... ol' skoolin it)
View 3 Replies
View Related
