JQuery :: Loading External HTML Pages Using .load() And Internal Is Not Working
Mar 16, 2010
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
View 5 Replies
ADVERTISEMENT
Oct 13, 2011
Is there any way to load the external HTML pages into a DIV with links.
For example if is click link 1 it has to load one.html, if I click link 2 it has to load two.html.
The link will be given in <a> tag itself. Example <a href="one.html">Link1</a> and
<a href="two.html">Link2</a>
I tried to load using the below script but the URL has to be given inside the script. But my requirement is it has to take from the href and load in the DIV id content.
<script type="text/javascript">
$(document).ready(function(){
$('a.more').click(function() {
[Code].....
View 5 Replies
View Related
Dec 28, 2010
I tried to load 1 html through ajax and javascript and it worked.But i want to load more than one and i cant.I thought that it would be a good idea to put the ajax files to the external websites and put the same load button.I tried this idea but it doesn work.I can only load one external website.
View 2 Replies
View Related
Aug 31, 2011
I was wondering if it is possible to load external pages (from a different server) into a lightbox, without using a iframe.
View 5 Replies
View Related
Aug 31, 2011
load external pages (from a different server) into a lightbox, without using a iframe.
View 6 Replies
View Related
Dec 9, 2005
I need a JavaScript code to load pages into another frame. The thing is, I want to control the pages that are loaded using an external javascript (.js) file.
View 7 Replies
View Related
Oct 15, 2009
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
showNewContent();
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top? Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
View 3 Replies
View Related
Jan 30, 2011
I am trying to load a div from one page, into a div on another page. On the webpage I am loading the new div to I put:
[Code]...
Why doesn't this work right? It looks right to me... what am i missing??
View 2 Replies
View Related
Mar 17, 2011
I'm fairly new to jquery so apologies if this is a very simple question with a very simple answer, but I just can't figure out the solution. I have an overlay div, and when I close the overlay I want to remove the html inside it and then re-load it from the specified file. I have already worked out how to empty the div, but what I now want to do is re-populate it with the content from a separate file on my web server.
[Code]...
View 1 Replies
View Related
Sep 6, 2010
from reading here and there understood that js does not work insuccessively .load() pages, yet I tried the proposed workarounds but could not get to work, perhaps lacking a bit of understanding about the eventhandlers, of whether there are just being not read inside the html or being ignored or... this html is being injected via .load() into a div which was injected the same way before already
[Code]...
View 4 Replies
View Related
Jun 19, 2010
Ok, I have 3 external pages I am loading in three locations on the page. So, I have the following in the head:
function allfunctions(){
clientSideInclude('center', 'http://127.0.0.1/cgi-bin/blosxom.cgi');
clientSideInclude('right', 'http://127.0.0.1/right.html');
clientSideInclude('left', 'http://127.0.0.1/left.html');
[Code]...
Now, this is great and each pages loads fine, but what happens is that NO javascript code will run. So, the right.html page has a few javascript commands and they do not load, same with left.html. Everything else loads fine though, I don't see what I can be missing.
View 1 Replies
View Related
Oct 15, 2009
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
Code:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top?
Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
View 1 Replies
View Related
Apr 18, 2010
how is it possible to use the load function after 10sec to load a external file? I googled for the delay(10000) option but be not able to include it into my script:[code]
View 10 Replies
View Related
Jan 31, 2010
I created a page (index.html, including the embedded javascript) with a div loaded by an external html content. But in this new content the click function I defined in the index.html page does not work in the new content. Then my question is: do i need to include all javascript in the external html content?
View 1 Replies
View Related
Jun 29, 2009
I have an ajax based page, which loads content from external page (html +js) So if i have a div "update_div" being updated with external content (html+js)
Let me be more specifig
Step1: Ajax content along with js loaded into update_div from a.html
Step2: Ajax content along with js loaded into update_div from b.html
What happens to the js loaded from a.html? Is it lurking in the memory or automatically/magically removed from the browser memory? I am afraid of memory leaks, if the js is still lurking in memory, the more ajax calls made, the more js is going to be held up in memory. Unless am totally wrong; i have no idea of the mechanism happening.
View 11 Replies
View Related
Sep 26, 2009
How to load external html (e.g. test.html) into index.html?
test.html contains links, div, css and its own javascript code.
I tried this [url] but it doesnt work. I can load external html file but it loads only css, links and div, not javascripot code which is attached to that file.
View 1 Replies
View Related
Nov 27, 2010
Is there a way onclick to load external html into a DIV tag, but without iFrame usage?
View 5 Replies
View Related
Oct 16, 2010
Load a random file, from a xml list, into a div. I've made a scheme where I show what I was trying to make, but I don't know how to make it. http:/ /img524 .imageshack.us /img524/3730 /randomm.jpg.I would like to load into a div a random HTML file, loaded from a XML.
View 1 Replies
View Related
Dec 19, 2005
I like having scripts external, but I wonder about the security of internal anyway. Someone could save and change the HTML, right? But is that possible with an external script? I always thought not (unless there was an error), until a person on this forum was able to grab the script I was working with at the time. No problem with that, but it brings up the question in my mind about security in general surrounding java-script.
View 8 Replies
View Related
Dec 8, 2011
I should write a script which should distinguish internal and external links with JS. The links can be absolute or relative. I thought the best guess would be to first check if it is a relative link by checking the first character of the string is a /. (but how do you do this?) Then it will be always an internal link.
Then I thought to check if the URL (this.href) starts with the current protocol + location.host . If YES, it is an internal URL, else it is an external URL.
So does anybody know how to check if a URL starts with '/' or '[URL]
View 1 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Jun 24, 2010
I'm using a function to load a page into a div. When I add the class of the element I want to show (.contentpaneopen) Chrome and Safari show no content. It works OK in IE and FF.When I ommit the class it works on all browsers.
function loadContent(elementSelector, sourceUrl) {
//Works in Chrome en Safari:
$(""+elementSelector+"").load(""+sourceUrl+"");
[code]....
View 1 Replies
View Related
Jul 19, 2010
My goal is to load the JS for a specific element before displaying that element. I integrated a third part script, and it works well. I set the timer here:
The JS is in my heading as <script type="text/javascript" src="countdownpro.js"></script>
About mid-body I have: <span id="countdown1">2010-07-20 00:00:00 GMT+00:00</span> which allows for the setting of a target date to countdown to.
When the page first loads it shows the above long format target time, until the js/meta tags kick in to modify it to just show the actual countdown as 00:00:00.
I have attached countdownpro.js to this post. I tried shifting the function CD_Init() to the top of the script, and also appended it inline with the .html. I tried setting the big external script to "defer", but neither arrangement worked. I also tried placing the src file right at the top.
View 2 Replies
View Related
May 16, 2011
I found jQuery simply amazing and been using this since then. My first and current version that I use is 1.4.2. My code below works fine in 1.4.2 until I upgraded to 1.6.1. I'm using CI for my php,btw.$("#ResultPanel").html(ajax_load).load("irs/login"+"#div_One"); After I upgraded to 1.6.1 Firebug reports "404 Page Not Found. The page you requested was not found". But when I switch back to 1.4.2 it works fine again. When I read the 1.6.1 release note it only says .attr() and prop() method nothing that I understand about .load().
my code that no longer supported in 1.6.1 released?
View 10 Replies
View Related
Jul 19, 2011
How to link two html pages? If we use <a> then what do wr give value to href?
View 3 Replies
View Related
Feb 15, 2011
I have the following code to load some pages into a div using the load function. When I click one of the links though, nothing happens. I have read a couple of books on JQuery and looking at the examples they give, this looks correct so I am at a loss.
[Code]...
View 4 Replies
View Related
