Loading Multiple External Html Pages At One Html Page?
Dec 28, 2010
I tried to load 1 html through ajax and javascript and it worked.But i want to load more than one and i cant.I thought that it would be a good idea to put the ajax files to the external websites and put the same load button.I tried this idea but it doesn work.I can only load one external website.
View 2 Replies
ADVERTISEMENT
Mar 16, 2010
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
View 5 Replies
View Related
Jun 19, 2010
Ok, I have 3 external pages I am loading in three locations on the page. So, I have the following in the head:
function allfunctions(){
clientSideInclude('center', 'http://127.0.0.1/cgi-bin/blosxom.cgi');
clientSideInclude('right', 'http://127.0.0.1/right.html');
clientSideInclude('left', 'http://127.0.0.1/left.html');
[Code]...
Now, this is great and each pages loads fine, but what happens is that NO javascript code will run. So, the right.html page has a few javascript commands and they do not load, same with left.html. Everything else loads fine though, I don't see what I can be missing.
View 1 Replies
View Related
Oct 13, 2011
Is there any way to load the external HTML pages into a DIV with links.
For example if is click link 1 it has to load one.html, if I click link 2 it has to load two.html.
The link will be given in <a> tag itself. Example <a href="one.html">Link1</a> and
<a href="two.html">Link2</a>
I tried to load using the below script but the URL has to be given inside the script. But my requirement is it has to take from the href and load in the DIV id content.
<script type="text/javascript">
$(document).ready(function(){
$('a.more').click(function() {
[Code].....
View 5 Replies
View Related
Oct 15, 2009
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
Code:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top?
Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
View 1 Replies
View Related
Feb 18, 2011
I have an external page with some rudimentary html in the source code missing many tags.. a bit like the below. On a page hosted elsewhere I need to take the html from this external page and add and remove certain parts of it and add some styling such as line breaks before ^FIELD01. I've looked at jquery and AJAX but cant find anything to suit my needs. I think what I am struggling with most is having this page in a variable to then be able to edit it.
Code:
^BEGIN SEARCH FORM
<form name="dancesearch" action="JJList.html?PHPSESSID=604918b69ab9936e638b5d48cdc142a3&xt=673">
^FIELD01: Dance Name<input name="ts" type="text" size="20" maxlength="25" />
[Code].....
View 1 Replies
View Related
Oct 15, 2009
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
showNewContent();
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top? Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
View 3 Replies
View Related
Jan 30, 2011
I am trying to load a div from one page, into a div on another page. On the webpage I am loading the new div to I put:
[Code]...
Why doesn't this work right? It looks right to me... what am i missing??
View 2 Replies
View Related
Mar 17, 2011
I'm fairly new to jquery so apologies if this is a very simple question with a very simple answer, but I just can't figure out the solution. I have an overlay div, and when I close the overlay I want to remove the html inside it and then re-load it from the specified file. I have already worked out how to empty the div, but what I now want to do is re-populate it with the content from a separate file on my web server.
[Code]...
View 1 Replies
View Related
Oct 11, 2006
The problem with using HTML as a report writer is primarily the
unreliable page breaking.
However it is a rather handy way of writing reports with images
embedded.
I could generate say 10 HTML pages of a maximum length to fit a page -
page1.htm, page2.htm, page3.htm ...etc.
Can I print all 10 pages, one after another automatically using perhaps
Javascript or some other method. Naturally dont want to ask the user
to do this.
Browser compatability would need to be I.E. 6 and Safari (not sure of
the version).
View 3 Replies
View Related
Jul 19, 2011
How to link two html pages? If we use <a> then what do wr give value to href?
View 3 Replies
View Related
Aug 31, 2011
I was wondering if it is possible to load external pages (from a different server) into a lightbox, without using a iframe.
View 5 Replies
View Related
Sep 22, 2006
All I need to do is; on the click of a button, import the numerical
data in an html form (only one field) to a cell in a spreadsheet. Both
spreadsheet and the html file reside on the same server but there are
no dynamic capabilities. All I can use is html pages + javascript (or
anything else which do not require any special programs to be installed
on the server). Is this at all possible?
View 2 Replies
View Related
Jun 30, 2011
I have just bought a JS animated web template. I made changes to the file names on the splash page (index.html) and 2 landing pages www.keithmacstanton.com/dez Now everything is all messed up.
View 3 Replies
View Related
Mar 8, 2010
I am in situation where I need a code to redirect a HTML page to new location (Static HTML/Dynamic Web page) however the challenge is that I can not use usual JavaScript Redirect code due to restriction that we can't execute any code/script under body tag.
I found that this can be done using an external JS file however I am not able to achieve this.
I need the code to be generic so we can apply the same JS file to any page. However, I want the new window to open over the previous one versus opening a second new window.
View 6 Replies
View Related
May 15, 2010
Something is up with my coding, when I try to load the page.. it will only load in notepad.
<html>
<head>
<title>Other ways to help</title>
<SCRIPT TYPE="text/javascript">
[Code].....
View 1 Replies
View Related
Jul 14, 2007
I need help getting variables in an external js file to transfer to the html page that uses them. I have an html page that lists verses to memorize, which, when the mouse hovers over a particular verse, a small popup reveals the book reference for that verse, thus giving a check to see if the user has accurately referenced that verse for its source.
I have an external js file (VERSES.js) that houses the verses and popup references sequentially as elements in an array and then writes them to the html document. A simplifed version of what I am using, with only a few verses listed here as an example, and that works beautifully, is given below: Code:
View 6 Replies
View Related
Mar 5, 2011
I actually use a counter on a webpage (It works). To do it, I use an inline javascript but I would like to unify the entire page and call that counter directly in the external Javascript that manages the whole site.
Here's the actual code...
Code:
HTML
<body onLoad=gen_hits()>
...
<span id='hits'></span><SCRIPT language="JavaScript" SRC="[URL]"></SCRIPT>
...
</body>
EXTERNAL JAVASCRIPT (ini.js)
var hits="HITS ";
function gen_hits() {
document.getElementById("hits").innerHTML=hits;
}
And here a "view" of my request...
Code:
HTML
<body onLoad=gen_hits()>
...
<span id='hits'></span>
...
</body>
EXTERNAL JAVASCRIPT
var hits="HITS " + <SCRIPT language="JavaScript" SRC="[URL]"></SCRIPT>;
function gen_hits() {
document.getElementById("hits").innerHTML=hits;
}
How to modify it ?
View 5 Replies
View Related
Aug 2, 2011
I have some code that works great when used inline (inside of an html page). The inline code looks like this and has an onchange = "gotoTest(this);" as part of the select element
<script type="text/javascript">
$(document).ready(function () {
$("select#RU").bind("change", gotoTest);
[code].....
View 6 Replies
View Related
Feb 9, 2011
I have seen some posts similar to this, but don't think I've seen any resolutions; other than perhaps it cannot be done. Have a set of html files (each one a segment of a page -- not full with a head, etc.). Am using jQuery ajax on a click event to load appropariate html file into a holding div.I've used the $('#gpsDetArea').load method as well as the ajax method:
[Code]...
View 16 Replies
View Related
Jun 29, 2009
I have an ajax based page, which loads content from external page (html +js) So if i have a div "update_div" being updated with external content (html+js)
Let me be more specifig
Step1: Ajax content along with js loaded into update_div from a.html
Step2: Ajax content along with js loaded into update_div from b.html
What happens to the js loaded from a.html? Is it lurking in the memory or automatically/magically removed from the browser memory? I am afraid of memory leaks, if the js is still lurking in memory, the more ajax calls made, the more js is going to be held up in memory. Unless am totally wrong; i have no idea of the mechanism happening.
View 11 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Dec 13, 2011
I have this javascript for a slideshow and I want to have in my html page multiple slideshows which can play in parallel the same time.
My script is :
Code:
<script type="text/javascript">
* Conveyor belt slideshow script- " Dynamic Drive DHTML code library [URL]
* This notice MUST stay intact for legal use
* Visit Dynamic Drive at [URL] for full source code
//Specify the slider's width (in pixels)
var sliderwidth="300px"
//Specify the slider's height
var sliderheight="150px"
//Specify the slider's slide speed (larger is faster 1-10)
var slidespeed=3 .....
View 4 Replies
View Related
Nov 21, 2011
I am looking for a multiple countup or age timer within a html page (using javascript). I want to display below each child picture the age clock/counter of the child. I do not know javascript well (I recognize some code) and know a little of html. I have searched on internet and nothing seems to get close to the below functionality. There are plenty of countup counters etc, but mostly count days, and those that do count age are single use only. Below is some code my friend found. That code works for one person/age only and includes weeks. The thing is that I want one page with all the children listed.
Example of Expected Outcome:
Picture John born in Thailand
John is 10 years, 03 months, 16 days, 12 hours, 14 minutes, 03 seconds old.
Picture Mary born in Florida, USA
Mary is 08 months, 12 days, 14 hours, 02 minutes, 53 seconds old.
Picture Chris born in Melbourne, Australia
Chris is 04 years, 02 months, 03 days, 01 hours, 06 minutes, 12 seconds old.
Picture Lindy born in The Netherlands
Lindy is 03 years, 11 months, 24 days, 23 hours, 44 minutes, 23 seconds old.
And the clocks keep ticking and counting up. Please note that since Mary is less than a year old, the 0 year value does not show. I also would like the possibility to consider the time differences between the places they were born and the time zone the web page viewer is in. Is that possible? Or maybe I have to recalculate their GMT (Greenwhich time zone) birth time for that to work, or maybe the time zone of the server? How can we make that accurate?
The hours, minutes, and seconds, would be great, but is of course optional. The code below also shows weeks, which is up to you to use or not. Maybe the script can allow you to choose which values to show? I would like this for at least four children, but the possibility to add more later by copying some code would be great. This is not an online form, so all time/date of birth details can be set in the script.
Here is the script I found:
<!-- Copy and Paste into HEAD of HTML-->
<SCRIPT type="text/javascript" language="JavaScript">
function ElapsedTime(inFromDate,inToDate) {
var inFromDate = (arguments.length == 0) ? new Date() : arguments[0];
var inToDate = (arguments.length == 1) ? new Date() : arguments[1];
// if (arguments.length == 0) var inFromDate = new Date(); // IE4 has a bug in constructors,
// if (arguments.length == 1) var inToDate = new Date(); // so use above method.
var fromDate = new Date(inFromDate);
var toDate = new Date(inToDate); .....
View 2 Replies
View Related
Jun 27, 2010
I need to have a simple text input field on a html page. It needs the users to type in either:
And depending on whats entered this will then take them to the corresponding:
Is this possible with javascript?
View 1 Replies
View Related
May 29, 2011
I have about 10 JQuery Books and they all talk about using Ajax(JQuery Load function) to insert either an HTML page or fragments of an HTML page into another page.
However, amazingly none of these books mentioned getting multiple items using the same function(document.ready).
Here is what I mean. I have a document.ready function which I use to get specific content from a page. However, to get additional items, I need to set up additional document.ready function.
So if I was retrieving 3 sets of content from a page, I will set up my script like this:
Code:
And the HTML
Code:
Is there a leaner better way to do this? Again all the books tells you how to grab a content, which I have done but do I have to create a new function for each item?
View 4 Replies
View Related