Page Not Loading In Html?
May 15, 2010Something is up with my coding, when I try to load the page.. it will only load in notepad.
<html>
<head>
<title>Other ways to help</title>
<SCRIPT TYPE="text/javascript">
[Code].....
ADVERTISEMENT
Loading Multiple External Html Pages At One Html Page?
Dec 28, 2010I tried to load 1 html through ajax and javascript and it worked.But i want to load more than one and i cant.I thought that it would be a good idea to put the ajax files to the external websites and put the same load button.I tried this idea but it doesn work.I can only load one external website.
View 2 Replies View RelatedJQuery :: Loading Html Page Segment Which Contains Script
Feb 9, 2011I have seen some posts similar to this, but don't think I've seen any resolutions; other than perhaps it cannot be done. Have a set of html files (each one a segment of a page -- not full with a head, etc.). Am using jQuery ajax on a click event to load appropariate html file into a holding div.I've used the $('#gpsDetArea').load method as well as the ajax method:
[Code]...
JQuery :: BlockUI : Not Working When Html Page Is Loading Data?
Aug 9, 2010I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
Loading PHP Seems Slower Than Loading HTML?
Dec 2, 2011I have a jQuery script that loads and displays a small window on a mouse hover. I use jQuery AJAX to load the content on that window. Having that, I noticed that loading the response from php file (which does not have a php code, only the file has .php on its name) is slower than the same file content with .html name. I wonder if this is a common problem or there is some issue with my codes. I will post my code if needed (if that seems to be the problem).Note: I mentioned that there is no php code in the php file because I am only testing the performance currently. After it is developed, there will be (obviously) php code in it.
View 2 Replies View RelatedJQuery :: Basic Page Loading DIV - Full Window DIV That Sits Above All The Content With A Loading Icon
Oct 21, 2009I have a site that is very jQuery and image heavy. The main sections of the site link to sections that are built with several Tabs, and as it loads, you briefly see all the content load and then it is hidden by the Tabs code.
The plan is to have a full window DIV that sits above all the content with a loading icon that plays until the entire page loads, and then it fades down.
After some hair pulling and research I have code in place that does exactly as I ask, however it does not seem to work in IE6+7. It works in all other browsers.
The current code is:
CSS for the loading DIV is:
A working link is [url]
Iframe :: Each Browser Shows The Loading Icon, As If A Page Was Loading?
Mar 19, 2010I have a lot of javascript functions that request information from an iframe hidden on the page. I see other sites do this, but their browser does not do the loading action (like the processing circle in Firefox). When I do it on my site, each browser shows the loading icon, as if a page was loading. Is it possible to not have this?
http://bit.ly/cv1YqN
That is a sample link. Go down right side of page where you see three buttons: Trailers Featurettes Clips.Those return iframe information to work.
Pre-loading A Page With Loading Image?
Oct 13, 2009I have created a party-events website. Which displays a lot of dates of events. As you might understand this page takes some time to load. Therefor I want some of loading image to be displayed while the page is loading. Anybody has an idea how to pull this of? I don't know how.
In detail: People come to my website. They click on "events" and a loading.gif pops up and and makes the background darker. After the page has completely loaded the loading image disappears and the website shows.
Password To Page.html - Simple Text Input Field On A Html Page
Jun 27, 2010I need to have a simple text input field on a html page. It needs the users to type in either:
And depending on whats entered this will then take them to the corresponding:
Is this possible with javascript?
Loading XML Into HTML?
Feb 3, 2010On the following page:[URL]I would like to load in content from an xml file, when the user clicks on one of the products from the sidemenu. The content will be an image and text for each type of headphone. I've been looking into it and I thought the best way would be to have 1 XML with all the content for each type instead of having one XML or one HTML for each type.
Code:
$(document).ready(function() {
$('#letter-d a').click(function() {
$.get('d.xml', function(data) {
[code]..
Cross-browser / Multi-browser "Loading Page" When Page Is Loading
Apr 29, 2009Like title says, I'm looking "Loading page" -notice when page is loading - made by Javascript. If you know Cross-browser/multi-browser example
View 1 Replies View RelatedLoading XML Into An HTML File?
Sep 8, 2009I'm currently working on my portfolio website and would like to have information about my movie clips be retrieved from an XML document when a thumbnail is clicked. I am building my website in HTML and would like to retrieve the Xml using JavaScript.
[Code]...
Loading External Html In A DIV?
Oct 15, 2009Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
Code:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top?
Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
How To Delay An Image/HTML Loading?
Jul 23, 2005I need to delay something either an image or a table from loading for 2-5
seconds. So far I have not find a good method.
I need the rest of the page, even the codes after the delayed image, to be
displayed in real time.
JQuery :: Loading A HTML Fragment?
Feb 7, 2010I have a login button which takes the user to the login page. Now... this to me seems like a slow way of logging in. I would like users who have javascript enabled to click the login button. Instead of them being forwarded to the login page, I want the login form to magically pop up on top of the web page.
I can do this, I can creative a div, add the html and probably with a bit of trying - get the user to login. However I have a question. For maintainability, I want to have create a separate HTML file, how would I insert this into my page using Javascript?
Furthermore speed is crucial, is there a way to have this fragment load in the background on every page? I am not sure what would be best, i just don't want a second or two wait when the button is pressed. Basically - in short - how to I load this file fragment? What is the fastest way to do this?
JQuery :: Loading External Html In A DIV?
Oct 15, 2009Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
showNewContent();
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top? Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
JQuery :: Loading External Html Into A Div?
Jan 30, 2011I am trying to load a div from one page, into a div on another page. On the webpage I am loading the new div to I put:
[Code]...
Why doesn't this work right? It looks right to me... what am i missing??
Loading HTML Structure Quickly ?
Jul 29, 2009I am trying to do the following without html frames.
-Let's say i a html file which contains the structure of a calendar (table, rows, cells, etc)
-Have javascript load the contents of the html file into the page without frames and without disturbing the previous content.
So the advantage is that i would not have to use javascript to create the structure of the calendar but instead to load it so that javascript only have to fill the contents of the calendar.
Loading A Html File Into A Div From A Link?
Mar 28, 2009i found a way to click a link and load it into a div. the only problem is that i keep getting the "AHA error" from the if statement in my div.
i'm not sure if it is me or the coding but i'll post what i'm using in jscript here:
function ahah(url, target) {
document.getElementById(target).innerHTML = ' Fetching data...';
if (window.XMLHttpRequest) {
req = new XMLHttpRequest();
[Code]....
i don't think it's because i'm using an image map (i know... ol' skoolin it)
Loading Other .html Pages With OnLoad?
Jun 19, 2010Ok, I have 3 external pages I am loading in three locations on the page. So, I have the following in the head:
function allfunctions(){
clientSideInclude('center', 'http://127.0.0.1/cgi-bin/blosxom.cgi');
clientSideInclude('right', 'http://127.0.0.1/right.html');
clientSideInclude('left', 'http://127.0.0.1/left.html');
[Code]...
Now, this is great and each pages loads fine, but what happens is that NO javascript code will run. So, the right.html page has a few javascript commands and they do not load, same with left.html. Everything else loads fine though, I don't see what I can be missing.
Loading External JS Before Page Page Load (specific Span Element)
Jul 19, 2010My goal is to load the JS for a specific element before displaying that element. I integrated a third part script, and it works well. I set the timer here:
The JS is in my heading as <script type="text/javascript" src="countdownpro.js"></script>
About mid-body I have: <span id="countdown1">2010-07-20 00:00:00 GMT+00:00</span> which allows for the setting of a target date to countdown to.
When the page first loads it shows the above long format target time, until the js/meta tags kick in to modify it to just show the actual countdown as 00:00:00.
I have attached countdownpro.js to this post. I tried shifting the function CD_Init() to the top of the script, and also appended it inline with the .html. I tried setting the big external script to "defer", but neither arrangement worked. I also tried placing the src file right at the top.
JQuery :: Make Iframe Page That Loading A Page From Other Site?
Oct 11, 2009i want to make a iframe page that loading a page from other site. I have try "jQuery iFrame Sizing" to set auto height in iframe... but it is failed.
This is my code :
-------------
on Head
<script type="text/javascript" src="js/jquery.js"></script>
<script type="text/javascript" src="js/iframe.js"></script>
on Body
[Code]....
Loading The Menu Item Page In The Center Of Main Page?
Mar 22, 2009I'm designing a web page, Having a banner on top, then a search option following it.There is a menu item list below it on to the left.And the content of the links of those menu item should get loaded in the center of the page.And a footer having some copyright info.All these are in div tags. The problem is when i click on any menu item it should be loaded in the center div tag.Ive tried using Iframes but there is a scrollbar coming only in that area of center div tag.I don't wan't this to happen.Based on the size of the html page to be loaded the div tag size should increase, and so the whole page.Have tried using Ajax but not working.
View 1 Replies View RelatedJQuery :: Loading Html From External File Into Div?
Mar 17, 2011I'm fairly new to jquery so apologies if this is a very simple question with a very simple answer, but I just can't figure out the solution. I have an overlay div, and when I close the overlay I want to remove the html inside it and then re-load it from the specified file. I have already worked out how to empty the div, but what I now want to do is re-populate it with the content from a separate file on my web server.
[Code]...
Loading Icon To Smooth HTML Injection?
Sep 4, 2010So what happens is that I have a page that uses a Javascript tab navigation div, named 'Tabber', working perfectly. Basically it picks up HTML tags with a specific classname and after the page is loaded it creates a small portion of HTML to create the desired effect. The problem is that it only does it after the page is loaded, which I am fine with it, but before that, the contents of that same div (that come from a SQL query) are not formated and the page just breaks apart untill the document is fully loaded (my current workaround is an overflow:hidden but...it is still ugly to watch), and only then it adjusts itself due to the right CSS propreties.
Now, it would be great if I could just have a loading icon showing up inside the div while the page is not loaded, so I can manage to hide that Javascript HTML injection process.
Ajax :: Loading A Set Of Objects At Runtime Wit Html?
May 5, 2009I need suggestion for this.After a particular option selection in my page,how to replace the rest of the contents of the same page with its response,and too making the select action invisible... can i do it using ajax wit html. for example,i have a select option,where for each option is attached a new set of objects,i want them to be loaded on the same page at run time,without page refresh...
View 1 Replies View Related