Loading XML Into HTML?
Feb 3, 2010
On the following page:[URL]I would like to load in content from an xml file, when the user clicks on one of the products from the sidemenu. The content will be an image and text for each type of headphone. I've been looking into it and I thought the best way would be to have 1 XML with all the content for each type instead of having one XML or one HTML for each type.
Code:
$(document).ready(function() {
$('#letter-d a').click(function() {
$.get('d.xml', function(data) {
[code]..
View 2 Replies
ADVERTISEMENT
Dec 28, 2010
I tried to load 1 html through ajax and javascript and it worked.But i want to load more than one and i cant.I thought that it would be a good idea to put the ajax files to the external websites and put the same load button.I tried this idea but it doesn work.I can only load one external website.
View 2 Replies
View Related
Dec 2, 2011
I have a jQuery script that loads and displays a small window on a mouse hover. I use jQuery AJAX to load the content on that window. Having that, I noticed that loading the response from php file (which does not have a php code, only the file has .php on its name) is slower than the same file content with .html name. I wonder if this is a common problem or there is some issue with my codes. I will post my code if needed (if that seems to be the problem).Note: I mentioned that there is no php code in the php file because I am only testing the performance currently. After it is developed, there will be (obviously) php code in it.
View 2 Replies
View Related
Sep 8, 2009
I'm currently working on my portfolio website and would like to have information about my movie clips be retrieved from an XML document when a thumbnail is clicked. I am building my website in HTML and would like to retrieve the Xml using JavaScript.
[Code]...
View 1 Replies
View Related
Oct 15, 2009
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
Code:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top?
Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
View 1 Replies
View Related
May 15, 2010
Something is up with my coding, when I try to load the page.. it will only load in notepad.
<html>
<head>
<title>Other ways to help</title>
<SCRIPT TYPE="text/javascript">
[Code].....
View 1 Replies
View Related
Jul 23, 2005
I need to delay something either an image or a table from loading for 2-5
seconds. So far I have not find a good method.
I need the rest of the page, even the codes after the delayed image, to be
displayed in real time.
View 5 Replies
View Related
Feb 7, 2010
I have a login button which takes the user to the login page. Now... this to me seems like a slow way of logging in. I would like users who have javascript enabled to click the login button. Instead of them being forwarded to the login page, I want the login form to magically pop up on top of the web page.
I can do this, I can creative a div, add the html and probably with a bit of trying - get the user to login. However I have a question. For maintainability, I want to have create a separate HTML file, how would I insert this into my page using Javascript?
Furthermore speed is crucial, is there a way to have this fragment load in the background on every page? I am not sure what would be best, i just don't want a second or two wait when the button is pressed. Basically - in short - how to I load this file fragment? What is the fastest way to do this?
View 3 Replies
View Related
Oct 15, 2009
Im loading a div of an external html (#right_in) into a div (#right) in my main movie this way:
var toLoad = divobj.id+'.html #right_in';
function loadContent() {
$('#right').load(toLoad);
showNewContent();
[Code]....
Is it possible to specify that the DIV has to load always at y=0, ie from the top? Because when I load another external div into my main div firefox keeps the latest position (if I scrolled before it loads the new page at that point).
View 3 Replies
View Related
Jan 30, 2011
I am trying to load a div from one page, into a div on another page. On the webpage I am loading the new div to I put:
[Code]...
Why doesn't this work right? It looks right to me... what am i missing??
View 2 Replies
View Related
Jul 29, 2009
I am trying to do the following without html frames.
-Let's say i a html file which contains the structure of a calendar (table, rows, cells, etc)
-Have javascript load the contents of the html file into the page without frames and without disturbing the previous content.
So the advantage is that i would not have to use javascript to create the structure of the calendar but instead to load it so that javascript only have to fill the contents of the calendar.
View 9 Replies
View Related
Mar 28, 2009
i found a way to click a link and load it into a div. the only problem is that i keep getting the "AHA error" from the if statement in my div.
i'm not sure if it is me or the coding but i'll post what i'm using in jscript here:
function ahah(url, target) {
document.getElementById(target).innerHTML = ' Fetching data...';
if (window.XMLHttpRequest) {
req = new XMLHttpRequest();
[Code]....
i don't think it's because i'm using an image map (i know... ol' skoolin it)
View 3 Replies
View Related
Jun 19, 2010
Ok, I have 3 external pages I am loading in three locations on the page. So, I have the following in the head:
function allfunctions(){
clientSideInclude('center', 'http://127.0.0.1/cgi-bin/blosxom.cgi');
clientSideInclude('right', 'http://127.0.0.1/right.html');
clientSideInclude('left', 'http://127.0.0.1/left.html');
[Code]...
Now, this is great and each pages loads fine, but what happens is that NO javascript code will run. So, the right.html page has a few javascript commands and they do not load, same with left.html. Everything else loads fine though, I don't see what I can be missing.
View 1 Replies
View Related
Mar 17, 2011
I'm fairly new to jquery so apologies if this is a very simple question with a very simple answer, but I just can't figure out the solution. I have an overlay div, and when I close the overlay I want to remove the html inside it and then re-load it from the specified file. I have already worked out how to empty the div, but what I now want to do is re-populate it with the content from a separate file on my web server.
[Code]...
View 1 Replies
View Related
Sep 4, 2010
So what happens is that I have a page that uses a Javascript tab navigation div, named 'Tabber', working perfectly. Basically it picks up HTML tags with a specific classname and after the page is loaded it creates a small portion of HTML to create the desired effect. The problem is that it only does it after the page is loaded, which I am fine with it, but before that, the contents of that same div (that come from a SQL query) are not formated and the page just breaks apart untill the document is fully loaded (my current workaround is an overflow:hidden but...it is still ugly to watch), and only then it adjusts itself due to the right CSS propreties.
Now, it would be great if I could just have a loading icon showing up inside the div while the page is not loaded, so I can manage to hide that Javascript HTML injection process.
View 1 Replies
View Related
May 5, 2009
I need suggestion for this.After a particular option selection in my page,how to replace the rest of the contents of the same page with its response,and too making the select action invisible... can i do it using ajax wit html. for example,i have a select option,where for each option is attached a new set of objects,i want them to be loaded on the same page at run time,without page refresh...
View 1 Replies
View Related
Feb 9, 2011
I have seen some posts similar to this, but don't think I've seen any resolutions; other than perhaps it cannot be done. Have a set of html files (each one a segment of a page -- not full with a head, etc.). Am using jQuery ajax on a click event to load appropariate html file into a holding div.I've used the $('#gpsDetArea').load method as well as the ajax method:
[Code]...
View 16 Replies
View Related
Aug 23, 2011
here we have my new site
[URL]
If you look good the source of this page, i have some .aspx load to .ajob div when i click image links...
here the piece of :
<div
class
="thumbnailMask"
> <ul
[Code].....
.aspx appears in this too :
[URL]
i want replace .aspx by xhtml or html in the same place then there
View 3 Replies
View Related
May 30, 2007
i'm using a little "ajax" loader script to dynamically load files into
different "div" tags on my main site. the code for this part looks
like:
View 13 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Feb 13, 2011
I am loading an entire page in ajax, but I just want to load a fragment from it. Using the .load() function, you can do this by adding a selector after your url like 'getPage.php #myDiv' etc, how to do it using the .ajax method.
I did some googling and found this solution:
$.ajax({
url: 'AjaxTest2.htm',
data: {},
cache: false,
[Code].....
I'm trying to get the "d1" div to be populated with the contents of the "my2" div on the second page. I don't want to use the .load() function, I want to use the .ajax() function. I can get this to work if I just use: $('#d1').html(data); instead of $('#d1').html($(data).find('#my2')); but the former results in the entire html contents of the second page being placed into the "d1" div, and I only want the fragement.
View 6 Replies
View Related
Mar 16, 2010
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
View 5 Replies
View Related
Feb 6, 2010
I came up with some code to load javascript files dynamically. But I've got problems..
When the script element is dynamically added to the head section of html, i think that the document.ready event fires once again and therefore the code sort of runs twice.
In the html page I call this method:
In the script test.js I have the function SayHi():
The SayHi method never gets called and alert('begin') & alert('getScript') get called twice in this sequence:begin begin getScript getScript.
View 1 Replies
View Related
Jun 8, 2011
I have only started to learn HTML, CSS, and Javascript (roughly 2 weeks now). I am having a issues regarding when I submit form data to the server. I want to temporarily disable the 'submit' button while the browser is loading and then reactivate it once everything has finished loading. This was my attempt at doing this.
[Code]....
View 1 Replies
View Related
Aug 26, 2010
Im trying to add some simple display features to a web application and am running into some unexpected IE8 behavior. Basically, the app runs some database retrieval from the server using Ajax techniques, and during that time (say, 30 seconds), I want to just give the user a clue as to whats going on. It could be as simple as a wait cursor. More interesting, I prefer to unhide a div with an animated loading icon, then hide it again when loading is complete.
[Code]...
View 3 Replies
View Related
Oct 21, 2009
I have a site that is very jQuery and image heavy. The main sections of the site link to sections that are built with several Tabs, and as it loads, you briefly see all the content load and then it is hidden by the Tabs code.
The plan is to have a full window DIV that sits above all the content with a loading icon that plays until the entire page loads, and then it fades down.
After some hair pulling and research I have code in place that does exactly as I ask, however it does not seem to work in IE6+7. It works in all other browsers.
The current code is:
CSS for the loading DIV is:
A working link is [url]
View 1 Replies
View Related
