I have a html document with some jquery which is working fine...i pasted the same code in aspx page but its not working properly...i am not able to make out where the problem lies...
View 3 RepliesI have a html document when i run in Internet explorer i am getting the desired output(j query working fine). But i copy pasted the same code in aspx page...the same code is not working properly...
View 9 Replies View RelatedI'm new to using JQuery and I've been searching everywhere to be able to post XML to a WebMethod on an aspx page in a site. I'm sure it can be done but I just have no idea how.
View 2 Replies View RelatedI have jQuery loading content from an aspx page - however, once this is loaded, jQuery doesn't appear to "see" the content. For example, in the code below, I am retrieving a table, with the class "stripeme" from the aspx page - I then try to add the mouseover/alternate row scripts, but my table does not change.
My main page is:
(page head info removed for length)
<script type="text/javascript">
function showDetails() {
var div = $("#divResult");
div.slideUp(function () {
div.load("getContent.aspx", .....
Should I add dynamic content, that I then want to manipulate using jQuery, in some other way?
I can obviously load an aspx page into a div container thru .load jquery function. But, if the aspx page is already enginereed to work with aspnet ajax (scriptmanager,etc) , this is lost and the first postback cause all the page to reload. My question is, how can I import an aspx page into a div, maintaining its own ajax functions ? In case it's not possible, what's the best way to get same result?
View 2 Replies View RelatedIn my home.aspx page ,asp.net application
<script
I downloaded this from the link: [url]
Actually it has been just 3 months i started using JQuery and its whole lot exciting with the things we can do using jquery. Is it possible to call a javascript function inside aaspx page created in sharepoint designer on a daily basis automatically .
View 1 Replies View Related1) how can i give absolute url to call GetDate method of default.aspx page?the problem is that, if my page is in a folder and accessing the Default.aspx page method.then it give error object not found, because my Default.aspx page is out side of the folder in which folder page it accessing the Default page method.
2) Is it possible to call a method which is in a class(not a .aspx page)or in a master page of .NET(method declared as Web Method)?
$.ajax({
type: "POST",
url: "Default.aspx/GetDate",
[code]....
i have a function test() in a external js file i want to call it in my .aspx page how do i call it i tries using dim dv= externalfile.getfilters() ealier my function was in the same page and hence wrking fine dv= getfilters()
View 2 Replies View RelatedI am trying to use xmlhttprequest to make my aspx page more interactive.
its a page with a slideshow where the user can rate the pic, send a comment of this pics and other stuff...
when the user rate or comment a pic, the server side script works properly, but when im going to work with the response (xmlhttprequestObject.responseXML), it all screw up...
this is some part of my scripts: Code:
I have five div tags(jquery tabs) in my aspx page...Inside the seconddiv(tab) i have a button. onclick of that buttton the second div(tab)should be switched..instead of that the first tab is coming.. How cani switch the tab in code behind(Inside button onclick event)...
View 4 Replies View RelatedTo get the row number in gridview when mouse is over the row. I need to pass the value to a control on an aspx page.
Does anybody know if it is possible with Javascript to get the actual cell data from the cell under the mouse in a gridview. The data i need is always in then first column ( column[0] ).
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
I need to have a simple text input field on a html page. It needs the users to type in either:
And depending on whats entered this will then take them to the corresponding:
Is this possible with javascript?
here we have my new site
[URL]
If you look good the source of this page, i have some .aspx load to .ajob div when i click image links...
here the piece of :
<div
class
="thumbnailMask"
> <ul
[Code].....
.aspx appears in this too :
[URL]
i want replace .aspx by xhtml or html in the same place then there
I am working on a page that will load in other pages using AJAX and the .html method. Something like this :
<span id = "edit">Edit</span>
<div id = "cont">
</div>
//the click edit script
[Code]....
Unfortunately this does not seem to work, entirely. It does trigger the click event but it messes up the post for some reason. I have played around with it for the last 45 minutes or so and it seems like the click event trigger is what is messing things up, if I comment it out it works fine. Could anyone tell me why they think this is? note this is an over simplified version of my actual code, but the structure is the same.
I have the following bit of jQuery:
Code:
$("#save_photos_all_continue").click(function() {
event.preventDefault();
var $black_white_all = $("#black_white_all").is(':checked');
var $color_all = $("#color_all").is(':checked');
var $other_all = $("#other_all").is(':checked');
[Code]...
In Google Chrome it works fine but in Mozilla/5.0 it actually goes to the save_edits page instead of just using the post and staying on the original page.
How to test if a html page has a parent page?Let me explain: I use the (great) Colorbox plugin and I like to apply jquery functions only if a page is in an Colorbox iframe.So, basically, I'd like to know how to determine with jQuery if a page has a parent page (= is in a Colorbox iframe).
View 2 Replies View RelatedI know how to employ .load() to bring a partial doc.html into a receptacle division upon menu selection, but am still unclear after reading the api whether I can also load a dedicated .css file for it ...I suppose prior to content load(?)... or if I can/should outfit the doc.html with <head><style> yada yada</style></head> and load it as one doc..
Or is one obliged to write out the entire styling for the doc.html in camelCase as a string enclosed in .css() ??
These are various stories fetchable via a menu. Each one has a different and detailed set of classes for styling..
Lastly, should I identify each story as an id or class?
What I'm not wrapping my head around is how to lay out the stylesheet. If a particular story ...(I'm using the same name as its document page (minus '.html')... is denoted as a class or id, then how do I assure that all the classes and id's which are in effect subordinate only to that id or class name also get loaded...?
On my webpage, I dynamically create an iFrame when a button is pressed, then load a html page from within my own domain into the iframe, based on what html page is loaded into a variable. My question is, can I dynamically change the font family of the loaded html page from the javascript of the main page? My code to create the iframe is:
function setSubTxt(){
var par = document.getElementById('parentDiv');
par.innerHTML = '<iframe src="'+subTxt+'" style="width: 375px; position: fixed; height: 365px; left: 400px; top: 145px; border=none;" name="subIframe" frameBorder=0></iframe>';
frames['subIframe'].window.location=subTxt;
document.subIframe.document.body.style.fontFamily = "Arial";
[Code]....
the variable "subTxt" has the url of the html page to be loaded (always on the same domain). The code: document.subIframe.document.body.style.fontFamily = "Arial"; was my attempt to dynamically change the font, but it didn't work. Also, it should be noted that there is no font family set in the html pages which would override this.
I have an html page that uses javascript to open a new window and
display a file that gets created when a button is pressed.
My problem is when the file is changed and the display button is
pressed, the old file is still displaying. I have tried using
<META HTTP-EQUIV=expires CONTENT=0><META HTTP-EQUIV=PRAGMA CONTENT=NO-CACHE>, but doesn't work 100% of the time.
I want to print a html page which has contents wrapped in several div tags. I need to insert page break after each div tag and the page numbers need to start from one, after each page break. I could insert page break using the following java script code.
var allDivs = document.all.tags("div");
for (i=0; i<allDivs.length; i++) {
allDivs(i).style.pageBreakAfter = "always";
}
But the page number is continuous. How can I change the page number for each pagebreak?
I need to refresh one div in my HTML page and not the entire page, is this possible?
View 4 Replies View RelatedI want program code only using html and javascript. First I took one form and created some data on it like
name:xyz
address:hyderabad
country:india.
hobbies:reading,cooking.
submit button.Above is one simple form after submit i want it to display it in another page like out.html.
It is possible to perform a find in page search that looks at a specific link, opens the page in a new window and finds the text within that document? Basically I regularly use an html page in work that has a list of people and their telephone numbers.I want to be able to type in a searchbox on my main page and it open the target page and find the name I am looking for?Is this possible or can you only Find In Page on the same page or another frame?
View 1 Replies View RelatedI'm doing 1 web-system, where login page in .jsp but other functional page in .html where I use javascript to do function. So if user knows any other html page's url then they can browse directly any of those page. But I've to prevent them & send to login page if they try to browse with out login. Very sad I can't do it
View 2 Replies View Related