Loading Js Locally Not Working - Only Remote - Get Error In Functions In The Page
Nov 18, 2010
I download the jquery library, when i include it as such:
It loads but i always get some sort of error in the functions in the page or something...as if the js is loaded but not correctly or as if it's missing, even though the download itself is correct
If i change the include path to (which is the exact same file i downloaded):
Everything works fine i am thinking maybe it could be something that has to do with encoding maybe? am not sure...any clue? it's only happening with the jquery JS files, the rest are working fine.
View 9 Replies
ADVERTISEMENT
Oct 18, 2010
I created a page a set of tabs, each tab loads an external page. The problem is that when I click on each tab, the external page contains script jquery and will not run.How I can do to upload the script to each page there is external?
View 1 Replies
View Related
Apr 1, 2010
I can use the jQuery ajax function to grab all of the html from a remote page, and that's cool. What I would like to do is to grab only a particular element of the remote page, not the entire page. Is this possible? I've tried some variations of the ajax 'url' param, but I haven't gotten anything to work yet.
View 3 Replies
View Related
Oct 26, 2009
i have problem, while loading of page in IE 6. i have software related website http://alisoft7.blogspot.comwhen i opened page. i have seen this error on status bar.
View 9 Replies
View Related
Nov 18, 2010
Im checking for validation on my page but also trying to submit the data to another form but if theres an error if still loads onto the other page is there any way i can stop this to allow the user to fix the errors?
View 1 Replies
View Related
Apr 10, 2009
I just realized that it seems like Internet Explorer doesn't get Javascript to work locally but only on a live site how can I get Internet Explorer to work locally? as well as live? For testing purposes. Everything runs right in Mozilla Firefox.
View 8 Replies
View Related
Oct 23, 2011
I am working on the following page: [URL]
There is a news script on the right-handside which rotates news items (a kind of scroller).
Locally this works without any problems, but once I've uploaded it to the hosting server this doesn't work. There is no javascript error sign.
I have double checked with the hosting and they support javascript by default.
View 3 Replies
View Related
Oct 23, 2011
I am working on the following page: [URL]. There is a news script on the right-handside which rotates news items (a kind of scroller). Locally this works without any problems, but once I've uploaded it to the hosting server this doesn't work. There is no javascript error sign. I have double checked with the hosting and they support javascript by default.
View 3 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Jun 15, 2009
In the new version of jquery.validate (1.5.3) there is an option to get a remote error message from the server for invalid elements. I did not find what should be the exact response from the server for producing such an error message. From the documentation: "The response is evaluated as JSON and must be true for valid elements, and can be any false, undefined or null for invalid elements, using the default message; or a string, eg. "That name is already taken, try peter123 instead" to display as the error message." But if i return a string, isn't it evaluated as true ?
View 2 Replies
View Related
Jun 14, 2009
I wanted to ask how it is possible to get error messages from the server till it is implemented in the remote method.What do you think is the less work intensive alternative.I also wanted to ask if i have two fields A and B, and the values of B depends on A. How do i make it with the plugin and the remote method ?I saw that there is a way of writing custom methods:URL...But how do i combine it with the ajax calls?
View 2 Replies
View Related
Sep 21, 2010
heres my header:
<script type="text/javascript" src="js/jquery-1.3.2.min.js" ></script>
<script type="text/javascript" src="js/jquery-ui-1.7.3.custom.min.js" ></script>
<script type="text/javascript" src="js/jquery.validate.js"></script>
heres my script:
[Code]...
View 14 Replies
View Related
Dec 10, 2010
I'm trying to load a remote URL (or rather just test to see if a remote page exists).
This works just fine:
But swap in a remote URL and I get nothing:
I don't actually need to load the remote URL, just determine if it's accessible (using it to test whether a user is connected to intranet or not). But I can't even seem to get to that.
View 4 Replies
View Related
Apr 14, 2009
I'm having a problem on a particular site I am working on.
The URL is [url]
The problem is that when I try to close the browser in IE on the main page I get an popup with an error which says: "An error has occured on the script on this page"
Do you want to continue running scripts on this page?
"Yes" or "No" (Buttons to Click)
I have to click the 'Yes' button about thirty times before the browser will finally close. Does anyone have any idea what this is?
Here is the source code.
Code:
View 2 Replies
View Related
May 4, 2009
I am new to javascript, I have one question, how can I use javascript to get the IP address of the remote user or remote web browser?
View 9 Replies
View Related
Oct 21, 2009
I have a site that is very jQuery and image heavy. The main sections of the site link to sections that are built with several Tabs, and as it loads, you briefly see all the content load and then it is hidden by the Tabs code.
The plan is to have a full window DIV that sits above all the content with a loading icon that plays until the entire page loads, and then it fades down.
After some hair pulling and research I have code in place that does exactly as I ask, however it does not seem to work in IE6+7. It works in all other browsers.
The current code is:
CSS for the loading DIV is:
A working link is [url]
View 1 Replies
View Related
Sep 23, 2005
I want to write a script that will read a .php file on a remote
server and print to the current page a portion of the text contained in
the remote file. I am just wondering what the best method is for
reading from a file in this case - the file is only a few bytes long.
I've seen a tutorial or two that only tangentially addresses my
problem, and even then each one has varied greatly as to which object
they utilize.
Any ideas to get me started?
View 4 Replies
View Related
Jul 19, 2009
Im wondering if there is any way to access and traverse through a remote web page. im trying to traverse through a remote web page from a diferent domain so i can display some text from that page to users. is it possible to do it using javascript if so how else what is the best way to do this with out keeping the user waiting for long.
View 2 Replies
View Related
Apr 20, 2010
I'd like to save a single page automatically. The page uses javascript, and therefore I can't seem to use links, elinks, lynx, w3m or curl (I've tried them with spidermonkey but it keeps telling me to enable javascript) to do so properly, it always saves everything except the javascript rendered output.
So I think the only what to do it would be in a web browser. So, say for intstance, I want to save the the main page, [url] and have it automatically save to my C:google.htm. How would I do that? Is this possible?
View 1 Replies
View Related
Aug 12, 2011
I'm trying to set a variable which a remote page can access. I can do this, but I need to set this variable inside "window.onload = functio(){". When I do this the remote page can't access it. This is a breakdown of what I'm doing:
Code:
View 2 Replies
View Related
Mar 19, 2010
I have a lot of javascript functions that request information from an iframe hidden on the page. I see other sites do this, but their browser does not do the loading action (like the processing circle in Firefox). When I do it on my site, each browser shows the loading icon, as if a page was loading. Is it possible to not have this?
http://bit.ly/cv1YqN
That is a sample link. Go down right side of page where you see three buttons: Trailers Featurettes Clips.Those return iframe information to work.
View 4 Replies
View Related
Aug 30, 2010
I am working on a site and in the process borrowed some js from some one to get dropdown menus to work, but after a while got reports from people who tested my site of some problems and decided to verify all my code, and i have fixed most bugs but the one listed in the title.
sfHover = function() {
var sfEls = document.getElementById("nav").getElementsByTagName("LI");
for (var i=0; i<sfEls.length; i++) {
sfEls[i].onmouseover=function() {
[code]....
View 7 Replies
View Related
Jul 25, 2011
Our app handles all users information via AJAX using jQuery. We return data.success or data.error depending on if it the API works or not. We also run the jQuery error() function on each post() just in case there is an actual problem reaching the server. It's getting tedious having the same thing for all of them.Here's a simplified example:
$.post('/api/nodeSave.php', {
net: true
}, function(data) {
[code]....
is there any way to add the trailing error() function as a default to all post() functions we run so I don't have to include it every single time?
View 2 Replies
View Related
Apr 20, 2010
I'd like to save a single page automatically. The page uses javascript, and therefore I can't seem to use links, elinks, lynx, w3m or curl (I've tried them with spidermonkey but it keeps telling me to enable javascript) to do so properly, it always saves everything except the javascript rendered output.
So I think the only what to do it would be in a web browser. So, say for intstance, I want to save the the main page, google dot com and have it automatically save to my C:google.htm. How would I do that? Is this possible?
View 1 Replies
View Related
Aug 28, 2009
I've used about everyone i've found online, with no success.The problem seems to be that these tooltips don't use the fully qualified domain to include pages just tip1.htm instead of somedomain.com/tip.htmTrying to create a "plugin" of script that people coming to the site can cut and paste into their own page and that code will show the content of my remote page.
View 5 Replies
View Related
Mar 25, 2011
im getting this error when on my script that rebinds functions and recreates dialogs, what could be the problem?I am using jQuery 1.5.1.min & jQuery UI 1.8.11
[Exception... "'Syntax error, unrecognized expression: "' when calling method: [nsIDOMEventListener::handleEvent]" nsresult: "0x8057001e (NS_ERROR_XPC_JS_THREW_STRING)" location: "<unknown>" data: no] Line 0
View 2 Replies
View Related
