JQuery :: Loading Image Before Operation Starts Not Working?
Jun 16, 2009
i have following problem: When the user on my website presses a image link, I prevent the default behaviour, and toggle some table rows (show or hide them, depending on the the image src (closed.gif / opened.gif)). Since I got a lot of rows I run over and toggle, the function takes some time to process and the browser "hangs" in the meanwhile. Due to this I want to show the user that the operation is still in progress and want to change the image of the link to a load spinner until it is finished. So I thought that I just have to change the src URL of the image in advance and then start the function, but jQuery is ignoring the line and I don't know why? Here is the code I am using:
$("a[name='changeDisplayModeAll']").click(function(e) {
e.preventDefault();
var newStatus;
var imageSrc = $("img[name='imageChange']").attr('src');
[Code]....
View 1 Replies
ADVERTISEMENT
Aug 30, 2011
I have a function that displays a loading icon just before the ajax call starts, but I wanted to display that icon only if the ajax call takes longer than 3 seconds. My question is: How to implement a counter after the ajax call?
Code:
View 2 Replies
View Related
Jan 28, 2011
Heres my code:
var interval = 1500;
var random_display = 0;
var imageDir = "grax/";
[Code]....
The show auto starts on 01.jpg, which is the second slide in the slide show, so I created a fake 00.jpg to move the images up one. This works fine except image 08.jpg shows twice at the end.
View 2 Replies
View Related
Jul 27, 2009
I have this loading.gif image that is 750px, when it should be 32px. The reason it's huge now is because my original solution was displaying two images: one 750px version of the loading.gif image and one 32px version (in the center of the 750px) of the same image. Now I'm at least down to one image, even if it's the wrong version.Click any of the thumbnail images here, and then again on the thumbnail at the top of that popup product gallery to see what I mean: need that huge loading.gif to be 32px like it should be, and then expand to 750px once the image is loaded. I've tried a bunch of solutions, but nothing has solved the problem.This is the code I have at the moment, although I'm working on the issue now so it may change.
$('#inline .thumbGrid img').click(function(){
var strLargeImg = document.getElementById('OBOEsac');
$('.galleryPopup').attr('src','/site/scripts/colorbox/images/loading.gif');
[code]....
View 1 Replies
View Related
Jun 27, 2009
http:[url]....but this example has a problem that after a new task has been added by ajax, it does not update the task lists ie suppose i have 2 task in the list now and now i add another one successfully, it showed me the message that 1 task has been added name "foobar" but in task list it still shows 2 tasks not 3.How to update the task list div>ul after the ajax operation Well I tried something like below
$('#submit').click(function(){
var note = $('#wrapper textarea').val();
if(note == defaultText || note == ""){[code].....
View 1 Replies
View Related
Jan 14, 2011
How to display loading gif image until the big image have loaded? Now I have the html and js but it doesn't work. Anyone have some idea or solution ?
[Code]...
View 1 Replies
View Related
Mar 18, 2011
I am looking for a jquery plug in that will make it easy to enter Hours of Operation ( to indicate when a business is open) as a form element. My current solution is Egor Khmelevs Safari Style Slider [URL]..) but it will not jump to where you click on the slider, and will only allow selection by dragging the pointers.
Is there a way to modify this plug in to accept click events to set the pointers? Or is there a better solution for what I am attempting? My hours of operation slider is just like the last demonstration on that page, except it spans 24 hours.
View 1 Replies
View Related
Sep 23, 2011
I have an array of divs, and can do a style change on them:
var Ray = new Array("first", "second", "nth");
function bluRay() {
$('#' + Ray.join(',#')).animate({color: '#00f'}, 600);}
( The divs don't share a class, and it'd be code-heavy to add classes for all the necessary variations on this function. )
How to make the operation on the divs sequential, at say, 500ms intervals?
View 2 Replies
View Related
Sep 13, 2010
I have tried this without success:
$("@font-face").css("font-family","myCustomFont");
$("@font-face").css("src","url('myFontLocation')");
trying to emulate the expected CSS3 statement:
@font-face {
font-family: "myCustomFont";
src: url("myFontLocation");
}
Is this possible? If so what is the exact syntax?
Searching found no clear answer, though I ran across Cufon and similar libraries, but I would rather stay in jQuery if possible.
View 2 Replies
View Related
Jan 28, 2010
AJAX Error: The data necessary to complete this operation is unavailablequery 1.3.2 do not have this error,jquery 1.4 have this error, how to solve?
View 1 Replies
View Related
Aug 19, 2011
$(".DdsConstant").each(function (index, element) {
var text = $(element).html();
$(element).html(text + ":"); });
The above code works for me, but I want to be able to skip the elements that already have a colon or question markin it.Example: Search Name: or Perform this daily? should be skipped. But Search Name should be changed to Search Name:. I will put question marks in manually. I have tried a few things and done some searches but no luck.
View 2 Replies
View Related
May 25, 2011
I'm just now trying to get my head around AJAX in general and jQuery's AJAX specifically.I have a table that is generated from php/mysql. A sample of the rendered page can be seen here. I've also attached a text document with the php code that generates the page.What I'm trying to do is, when a user clicks on one of the edit buttons, I want to open a jQuery UI Dialog popup and populate a form with the current information for the class the user clicked on. Then, after the user clicks on a Submit button (and some basic validation), jQuery's ajax() sends the data for processing to a php script. Upon successfully processing the changes to the class I want to close the Dialog popup and show the changes in the table on the main page.[code]
View 4 Replies
View Related
Oct 13, 2009
I have created a party-events website. Which displays a lot of dates of events. As you might understand this page takes some time to load. Therefor I want some of loading image to be displayed while the page is loading. Anybody has an idea how to pull this of? I don't know how.
In detail: People come to my website. They click on "events" and a loading.gif pops up and and makes the background darker. After the page has completely loaded the loading image disappears and the website shows.
View 3 Replies
View Related
Sep 9, 2010
I am using jcarousel for a scrollable list of images (vertical). Unfortunately, when you try to scroll it the first time you enter the website its not working properly. Just when you try to visit the site the second time it the scrolling will work as intended (when cache deleted, again, it will not work). [URL]. To load the script earlier, I tried to already put it in the head of the index page (starting page), but this had no effect. The Problem is for IE and Firefox the same. I am using Dreamweaver CS4.
View 1 Replies
View Related
Dec 28, 2011
I loaded the jquery ajax file in Div id:main_content, but in another div id:List <a> tag is not working. Both Div i loaded the the content as ul,li format.
View 1 Replies
View Related
May 6, 2010
Using jQuery's plugin GalleryView http:spaceforaname.com/galleryview. I am able to get the gallery to load on a page refresh with $(document).ready(function(){
$('#photos').galleryView({show_panels: true,show_filmstrip: true,panel_width: 400,panel_height: 300,frame_width: 100,frame_height: 100});
});
I even tried that with the jQuery livequery plugin, which creates an infinite loop. I tried searching google for a solution, and only found one thread after extensive searching of people having the same issue of getting this plugin to work with ajax, but there was no solution. this is the thread
[Code]...
View 4 Replies
View Related
Nov 17, 2010
In one of my web page I want to show an image preloader. ie When I clicked on the small thumbnail in my web page then the main large image will load. My code looks something like this
$("#images li").click(function(){
var image=this.href;
$("#mainImage").attr('src',image);
});
I want to show the Loading sign until the main image loads completely.
View 1 Replies
View Related
Jun 10, 2011
I would like to get the function to find the value which is starts with given value in select Box. If jQuery does not support please let me know how to do using Java script.
I am using contains function but it returns all the matched values. Get the value value exactly starts with given value.Select box :
<select class="widthed1" name="dynamicitem" id="dynamicitem" multiple="multiple" size="7" >
<!-- Will be added dynamically -->
</select>
$("#dynamicitem option:contains
('"+oldval+"')").attr("selected","selected"); -- It returns all the matched values.
View 8 Replies
View Related
Jun 4, 2009
I have a jquery slidedown effect which id triggeref onchange of dropdownBut the slide down effect starts a few seconds after the option is change.It delays
View 1 Replies
View Related
Feb 11, 2011
I have written some JAVA code that pulls and image from a DB and writes out the byte stream.When I call the URL directly I can see my image, however when I use something like:
function loadImage(filename) {
$(document).ready(function() {
alert('loadImage Called with ' + filename);
[code]....
View 4 Replies
View Related
Aug 19, 2011
I am attempting to stop the loading and replace images with processed ones using the below code, the problem seems to be that even though I am removing the src attribute the original image still loads.
[Code]...
View 6 Replies
View Related
Mar 8, 2011
I have the following navigation links:
HTML Code:
<a href="images/apollohaga.jpg" title="a" id="productlink">Num 1</a><br />
<a href="images/apolloherr.jpg" title="b" id="productlink">Num 2</a><br />
<a href="images/apollodam.jpg" title="c" id="productlink">Num 3</a><br />
[Code]....
I have tried all sorts of things to get this working but no luck so far.
View 16 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Mar 8, 2011
How do I check if the method of text() starts with a 1
View 1 Replies
View Related
Oct 21, 2009
I am using the table of contents function of rebecca murphey. The script works fine, but i need to extend itin two ways.
1. set a number for each toc element?
2. set exactly this number to he h1 inner html in fron of the text?
So that the result is[code]...
View 5 Replies
View Related
Apr 27, 2010
I am building a navigation which animates width on mouseover and revert it on mouseleave. That navigation also supports keypress/keydown actions, so it behaves like you hover with the mouse and additionally opens the submenu too. My problem is, when using the keydown (C) function, the menu opens up perfectly but when I mouseover then, it fires the 1. function and behaves like it should, it closes. I tried to stop that when just using keydown, but somehow I am stuck with it. Here comes the code:
$
(
function
()
[Code]....
View 4 Replies
View Related
