JQuery :: JCarousel Only Working On Second Loading

Sep 9, 2010

I am using jcarousel for a scrollable list of images (vertical). Unfortunately, when you try to scroll it the first time you enter the website its not working properly. Just when you try to visit the site the second time it the scrolling will work as intended (when cache deleted, again, it will not work). [URL]. To load the script earlier, I tried to already put it in the head of the index page (starting page), but this had no effect. The Problem is for IE and Firefox the same. I am using Dreamweaver CS4.

View 1 Replies


ADVERTISEMENT

Jcarousel Is Not Working Properly At Site?

Jun 27, 2011

We have jcarousel on our forum site which rotates automatically. It is vbulleting forum. In fact originally it was working fine with old design and rotating images automatically in horizontal direction with a set of 5 images visible at a time and total 12 images in set.

But we have upgraded our forum design in last week and I started getting issues with Jcarousel scroller.

Our site URL is [URL]

While old site design is still active at Parenting Forums - Natural Parenting Forum

At new design when we implemented jcarousel scroller it is showing only one image in a horizontal row at jscroller and it disappears immediately and after 3-4 min it do reappear again. When I inspected it using firebug I have noticed that other images are coming below vertically not horizontally, really strange. Also I noticed another thing is that it is not updating width at element.style in firebug for UL tag. It is showing fix width 220 px all time. I think due to that all images appearing vertically one after one rather than horizontally.

Code:
<style type="text/css">
.jcarousel-skin-tango .jcarousel-container {
-moz-border-radius: 0px;
background: transparent;

[Code].....

View 3 Replies View Related

JQuery :: Anchor Tag Is Not Working After Loading Ajax?

Dec 28, 2011

I loaded the jquery ajax file in Div id:main_content, but in another div id:List <a> tag is not working. Both Div i loaded the the content as ul,li format.

View 1 Replies View Related

JQuery :: GalleryView - Loading Via Ajax Not Working?

May 6, 2010

Using jQuery's plugin GalleryView http:spaceforaname.com/galleryview. I am able to get the gallery to load on a page refresh with $(document).ready(function(){

$('#photos').galleryView({show_panels: true,show_filmstrip: true,panel_width: 400,panel_height: 300,frame_width: 100,frame_height: 100});
});

I even tried that with the jQuery livequery plugin, which creates an infinite loop. I tried searching google for a solution, and only found one thread after extensive searching of people having the same issue of getting this plugin to work with ajax, but there was no solution. this is the thread

[Code]...

View 4 Replies View Related

JQuery :: Loading Image Before Operation Starts Not Working?

Jun 16, 2009

i have following problem: When the user on my website presses a image link, I prevent the default behaviour, and toggle some table rows (show or hide them, depending on the the image src (closed.gif / opened.gif)). Since I got a lot of rows I run over and toggle, the function takes some time to process and the browser "hangs" in the meanwhile. Due to this I want to show the user that the operation is still in progress and want to change the image of the link to a load spinner until it is finished. So I thought that I just have to change the src URL of the image in advance and then start the function, but jQuery is ignoring the line and I don't know why? Here is the code I am using:

$("a[name='changeDisplayModeAll']").click(function(e) {
e.preventDefault();
var newStatus;
var imageSrc = $("img[name='imageChange']").attr('src');

[Code]....

View 1 Replies View Related

JQuery :: BlockUI : Not Working When Html Page Is Loading Data?

Aug 9, 2010

I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area

>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG

[code]....

View 2 Replies View Related

JQuery :: Loading External HTML Pages Using .load() And Internal Is Not Working

Mar 16, 2010

I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:

<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>

Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:

[Code]...

View 5 Replies View Related

JQuery :: Adding Specific Class For Loading Content Using Load() Not Working In Chrome/Safari?

Jun 24, 2010

I'm using a function to load a page into a div. When I add the class of the element I want to show (.contentpaneopen) Chrome and Safari show no content. It works OK in IE and FF.When I ommit the class it works on all browsers.

function loadContent(elementSelector, sourceUrl) {
//Works in Chrome en Safari:
$(""+elementSelector+"").load(""+sourceUrl+"");

[code]....

View 1 Replies View Related

JQuery :: JCarousel Overloads With More Than 12 Images

Apr 26, 2011

Everything was perfect until I uploaded one too many pictures. Using "SmoothSlider" for Wordpress and it seems that jCarousel 'overloads' when there are more than 12 images. Here is what happens on the page:
display: block; overflow: hidden; position: relative; top: 0px; margin: 0px; padding: 0px; left: -43650px
; width: 72750px;
left: # ; reaches a 'limit' approximately around 10,000px and results in the slider sliding back to the first image (left: 0px++) and then it goes to the correct pixel size.
View the page here: [URL] and try it your self.

View 2 Replies View Related

JQuery :: JCarousel - Next Still Enabled On Last Item

Aug 18, 2009

i am using [URL] when i have reached the last item, where the next button shld have been disabled, its still enabled leading to an extra space when next is clicked. [URL]

View 2 Replies View Related

JQuery :: JCarousel Not Rendering Images In IE?

Jul 1, 2009

Has anyone had a problem where JCarousel does not render images in IE 8 but works fine in FF?

View 1 Replies View Related

Jquery :: 'kill' JCarousel After Setting 'gallery'

Nov 10, 2011

I have a problem on my website that I'm doing for a company, they have a Wordpress blog, and the blog page is set as a static home page, which is great. The problem is, the Atlantica theme puts a gallery on much of the blog, and worse, makes an even bigger gallery on the Home page (lucky me:-/). With some twiddling, I quickly figured out that I could just set the div "gallery" to "display: none" via CSS, and wah-LA! it disappeared..until 5 seconds later, when the error message "jCarousel: No width/height set for items. This will cause an infinite loop. Aborting..." continues to re-assert itself, provides an OK to out of the error message, and keeps pestering me again.

I know next to nothing about the format of JScript. I've tried if/then statements, but once again, I'm so new at this, that I haven't gotten that far. I'm a whiz at CSS, but Javascript is kind of kicking my tail.

View 13 Replies View Related

JQuery :: Jcarousel Not Scrolling Through All Items In List / Fix It?

Jan 27, 2011

I have 21 items in the list, but scrolling by hitting the right(next) icon only takes me to the 13th item and stops.

View 1 Replies View Related

JQuery :: Disabling JCarousel Image Selection?

Sep 17, 2009

I've encountered a minor but annoying bug in jCarousel.

1. Go to http://sorgalla.com/projects/jcarousel/examples/dynamic_javascript.html

2. Double click the right arrow button.

3. Notice some of the images and middle section get the selection

[Code]...

View 1 Replies View Related

JQuery :: Get Active Image Centeres In JCarousel?

Oct 19, 2009

I use jcarousel in one of my project. As we know active image in jCarousel, default set in the left or right. Can i customized so active image will centered? Let say there's 5 image and i want image number 3 in the middle is set as active image.

View 4 Replies View Related

JQuery :: JCarousel External Control As Pagination

Aug 4, 2009

I have a couple of problems using jCarousel, and was hoping someone here might lead me to a solution. First of all, can I change the way the External Control function works? I am guessing that I "only" need to edit the javascript file, but having little knowledge of it, I chose not to. What I want to do, is use the External Controls as a pagination, so rather than being a navigation for each image, I would like it to navigate from one page of visible images, to another. More or less, I accomplished it by setting the value inside the <li></ li> to the number I wanted to navigate to.

However, this resulted in ridiculous number always increasing by the number of visible items (have a massive amount of images loaded).

So really, the question is:How can I navigate to a specific image in the carousel using a onclick function? Which brings me to the other problem, the External Controls behave as a list of navigation-buttons. If my carousel shows 500 images, it will generate 500 buttons for navigating. How can I automatically shorten it (as the Pagination Plugin does; [url])? Thinking about it, making such a pagination would be much easier if I knew how to solve the first problem.

View 1 Replies View Related

JQuery :: JCarousel External Control As Pagination?

Aug 4, 2009

(tried posting this earlier without result), I have a couple of problems using jCarousel, and was hoping someone here might lead me to a solution. First of all, can I change the way the External Control function works? I am guessing that I "only" need to edit the javascript file, but having little knowledge of it, I chose not to. What I want to do, is use the External Controls as a pagination, so rather than being a navigation for each image, I would like it to navigate from one page of visible images, to another. More or less, I accomplished it by setting the value inside the <li></ li> to the number I wanted to navigate to. However, this resulted in ridiculous number always increasing by the number of visible items (have a massive amount of images loaded). So really, the question is: How can I navigate to a specific image in the carousel using a onclick function? Which brings me to the other problem, the External Controls behave as a list of navigation-buttons. If my carousel shows 500 images, it will

[Code]...

View 2 Replies View Related

JQuery :: JCarousel Appears Vertical Then Horizontal?

Jul 7, 2009

I am using jCarousel and I am getting a weird bug. Basically, jCarousel renders perfect - however for a brief instant the carousel appears vertically and then appears horizontal as it should in IE / FF

View 12 Replies View Related

JQuery :: JCarousel - Execute The Codes Only Before The Next Button Is Click?

Mar 24, 2011

I have implement jCarousel onto my website, my jCarousel has 8 items on each page, when user click "Next" button, then jCarousel will display item 9 until item 16. I want to execute a certain codes only when jCarousel is displaying item 1 to item 8. In other word, I want to execute the codes on 1st page only. In other word, I want to execute the codes before click the "next" button. How to do that? I not sure which 1 should I use? Should I use itemFirstInCallback or itemVisibleInCallback or buttonNextCallback? I refer to this website[URL]..jQuery/jCarousel/ but there is not example or guideline about how to use them. Can anyone guide me how to use those functions?

View 1 Replies View Related

JQuery :: Trying To Customize JCarousel To Do AJAX Loads With XML Response

Jun 26, 2009

I sort of see examples in how to lazy load via AJAX request for the jCarousel.But the examples here are geared toward specific APIs such as Fickr.URL...So basically what I'm trying to do is make a jQuery ajax request to one of our URLs that goes to an HttpHandler and spits back XML in the response.Obviously this is our own custom XML so I looked at the source examples on some of what he did with calling the Flickr url to
defer loading but I don't know how hard it would be to tweak this plug-in or what to tweak in order to parse my own incoming XML in the response and then get the list items to show dynamically in the <ul></ ul> So I don't know where to start on this. I guess I can look at the source of this plug-in but man, I will still need some assistance on this.

View 7 Replies View Related

JQuery :: Get JCarousel To Fetch New Set Of Records On Click Of Next Button?

Jun 30, 2009

I've been trying for the last 2 days to get this thing to call my getJSON and fetch a new set of records based on the carousel.last value when you click the next button. It loads 3 pictures on start up just fine but the next button is not enabled because I only have 3 loaded and there are no more lingering in the queue. I don't want any lingering.

[Code]...

View 5 Replies View Related

Pre-loading Images Not Working?

Sep 14, 2005

I have following type of code in the header

function pre_load_pics()
{
if (document.images)
{
var image1 = new Image(400,265);
image1.scr = "pic1.jpg";
var image2 = new Image(400,265);
image2.scr = "pic2.jpg";

etc etc

}

and the following in the body

<script>
pre_load_pics();
</script>

but images are not downloaded until the app needs them later. Something wrong ? I thought they should be downloaded earlier?

View 15 Replies View Related

JQuery :: Create A Fadein / Out Between Images Combined With JCarousel Lite?

Dec 26, 2010

I'm not very experienced with jQuery yet and after a while of trying and searching I decided to ask for help here:

I'm using jCarousel Lite, the "Custom Widget" scenario (click in the list on the left)[url]

When clicking on a image in the carousel, the larger image is shown immedeately. I'm trying to achieve a fadeout, fadein effect. Doesn't need to be a crossfade, a fade out to white, fade in from white is fine.

My 'bare' code (this works, with instant showing of pictures, without any fades)[code]...

View 1 Replies View Related

JQuery :: Stop JCarousel Before Datas Are Finished Load From A Php File?

Mar 18, 2011

[code]Now I use firebug to inspect the 3 <li> again, then I realize the 3 <li> don't have class, style and jcarouselindex anymore. I guess it is because the function inside jcarousel.min.js file is execute first before the 3 <li> are finish sent from usermessage.php file. How to stop jcarousel funtion before 3 <li> is finish loaded? I saw there is an example of the way to stop jcarousel function but it is for xml data, I don't know how to convert it to php. I hope somebody can help me out about this. Below is the example of the way to stop jcarousel function but it is for xml data.[code]

View 2 Replies View Related

JQuery :: JCarousel Click Item And Move It To First Visible Position

Feb 2, 2011

in jCarousel i have a list of items, what i would like to be able to do is when the user clicks on an item (say the 4th visible item in the list) the carousel would scroll so that the clicked item becomes the first visible item in the list.

View 1 Replies View Related

JQuery :: Infinite Loop Alert On Combing Jcarousel And Google Map?

Jun 2, 2009

I have some problems about using jcarousel library on Google Map, and following is my scenario: there is a Marker on the Map, and when clicking on the Marker,Info-Window will pop up, and jcarousel content will be in the Info- Window And This is a simple demo:

[Code]...

View 1 Replies View Related







Copyrights 2005-15 www.BigResource.com, All rights reserved