JQuery :: GalleryView - Loading Via Ajax Not Working?

May 6, 2010

Using jQuery's plugin GalleryView http:spaceforaname.com/galleryview. I am able to get the gallery to load on a page refresh with $(document).ready(function(){

$('#photos').galleryView({show_panels: true,show_filmstrip: true,panel_width: 400,panel_height: 300,frame_width: 100,frame_height: 100});
});

I even tried that with the jQuery livequery plugin, which creates an infinite loop. I tried searching google for a solution, and only found one thread after extensive searching of people having the same issue of getting this plugin to work with ajax, but there was no solution. this is the thread

[Code]...

View 4 Replies


ADVERTISEMENT

JQuery :: Initialization Galleryview In Ajax Callback?

Aug 25, 2010

I use the JQuery GalleryView-Plugin [URL]. The initialization works fine if i use this code:

<script>
$(document).ready(function() {
$('#gallery').galleryView({
gallery_width: 200,

[Code].....

View 1 Replies View Related

JQuery :: Anchor Tag Is Not Working After Loading Ajax?

Dec 28, 2011

I loaded the jquery ajax file in Div id:main_content, but in another div id:List <a> tag is not working. Both Div i loaded the the content as ul,li format.

View 1 Replies View Related

Ajax :: Loading Images In Interactive Way Not Working

Nov 19, 2010

i have working with an aplication and like you can see, by clicking in a line at the right, each one displays a different image. When the image is loaded, there's a javascript code for re-measurement, for adjusting to the available screen area.but unfortunately the result is the image is loaded at its original size. The objImage.src is well retrieved from AJAX, like i can test with the alert: the getsrc.php?id="+img opens a MYSQL query on the database and returns the matching path to the img id, which is set before.

View 9 Replies View Related

JQuery :: Galleryview Taking Ages To Load - Over 40 Seconds

Nov 2, 2010

I'm using GalleryView, but its taking ages (over 40 seconds) to load. I have about 18 images, 700 x 400 px.

I've just seen another website that loads almost this many and size instantly.

[url]

View 3 Replies View Related

AJAX :: IE8 Not Rendering - Unhide A Div With An Animated Loading Icon - Then Hide It Again When Loading Is Complete

Aug 26, 2010

Im trying to add some simple display features to a web application and am running into some unexpected IE8 behavior. Basically, the app runs some database retrieval from the server using Ajax techniques, and during that time (say, 30 seconds), I want to just give the user a clue as to whats going on. It could be as simple as a wait cursor. More interesting, I prefer to unhide a div with an animated loading icon, then hide it again when loading is complete.

[Code]...

View 3 Replies View Related

GalleryView Works But Only Sporadically

Apr 24, 2011

I'm utilizing jQuery GalleryView for a website and I'm having a problem with it showing up. I have two different pages that use it. Within Firefox they will only seem to work after I switch between the two or refresh a couple of times, and even then it's a crapshoot. In IE, they never work, one of the pages briefly flashes the content in rough form during load but then goes blank. These both work 100% of the time when testing through Dreamweaver to Firefox, and don't work through Dreamweaver to IE. Here is my Javascript and some of my html code for both pages.

Page 1:
HTML Code:
//Javascript
<script src="http://code.jquery.com/jquery-1.5.2.min.js" type="text/javascript" ></script>
<script type="text/javascript" src="Scripts/jquery-ui-1.8.11.custom/js/jquery-ui-1.8.11.custom.min.js"></script>
<script type="text/javascript" src="Scripts/galleryview-3.0b3/js/jquery.timers-1.2.js"></script>
[Code]...

View 2 Replies View Related

Query :: All IE Browsers And Gallery From Galleryview

Jul 13, 2010

all IE browsers and my jQuery Gallery from Galleryview. Background: I am using Java to do an image search and build up some HTML including the calls to run the galleryview scripts and return this back to the page using document.write() When I use the simple structure of placing the scripts and parameters into a sample page:

[Code]...

View 2 Replies View Related

JQuery :: JCarousel Only Working On Second Loading

Sep 9, 2010

I am using jcarousel for a scrollable list of images (vertical). Unfortunately, when you try to scroll it the first time you enter the website its not working properly. Just when you try to visit the site the second time it the scrolling will work as intended (when cache deleted, again, it will not work). [URL]. To load the script earlier, I tried to already put it in the head of the index page (starting page), but this had no effect. The Problem is for IE and Firefox the same. I am using Dreamweaver CS4.

View 1 Replies View Related

JQuery :: Ajax Loading In The Same DIV 1 Time Yes And 1 Not?

Jan 6, 2010

You need the link to be out side the div you are loading your content into. As the line "$('#wrapper_of_subpages').load(this.href + " #wrapper_of_subpages");" in your code don't copy the event with the link you need some other way to keep your link event.

View 4 Replies View Related

JQuery :: AJAX Only Loading One Time In IE?

Oct 19, 2011

I am working on a page which uses a JQuery AJAX to call another php page that displays a list of random items and reloads every 2 seconds. The below code works in Chrome and FF but only once in IE,

[Code]...

View 4 Replies View Related

JQuery :: Ajax For Loading Drop Down Menus?

Sep 6, 2010

I've used the ajax function to load in data like "click the submit button, ajax executes output.php and throws in back into a div tag in theform.php."

But what if I have a multiple dropdown menus that submit the form and need to be reloaded depending on the previous dropdown menu's value? How would I set up the ajax so those are loaded without a refresh?

View 7 Replies View Related

JQuery :: Ajax Loader To Appear In Between Page Loading

Aug 19, 2009

I'm creating a site using AJAX and I would like for an ajax loader to appear in between the page loadings.
$("#menu ul li").click(function(event) {
$("#ajaxLoader").show(function(){
alert('hello');
});
setTimeout("jQuery.fn.test("about");", 3000);
});});
jQuery.fn.test = function(page) {
$("#content").load(page + ".html");
$("#ajaxLoader").hide(function(){
alert('good bye');
});};
This works perfectly the first time - the ajax loader appears for about three seconds before disappearing and instead the page is displayed. But the second, third, fourth ... time, the ajax loader never shows up.

View 2 Replies View Related

JQuery :: Using Tabs And Loading Content By Ajax

Sep 21, 2010

I use tabs, loading content by ajax. When I click on a tab, on first load, any access to objects like:
$("#my_input_text").val('my value')
Works fine, but if a click on another tab, and click again to theprevioustab, the same code don't update the input text.I think that is because the document has 2 inputs with the same id after second refresh.

To prove this, I did, on javascript console of firebug:
document.getElementById('my_input_text').id = "bad_my_input_text";
and$("#my_input_text").val('my value')
works again. Exist some way, when click on a new tab, before load a content, clean all data from previous tab?

View 2 Replies View Related

AJAX (jQuery) Loading Images Blindly

Oct 20, 2011

I've got image files named 0-0, 0-1, 0-2 and so on up to a certain point, and I want to load each file until it can't find another, hence the jquery ajax error. At the moment, this works in firefox only.

Code:
for (var i = 0; i < _images.length; i++) {
var ready = 1;
var count = 0;
var arr = [];

[code]....

View 5 Replies View Related

JQuery :: Loading Image Before Operation Starts Not Working?

Jun 16, 2009

i have following problem: When the user on my website presses a image link, I prevent the default behaviour, and toggle some table rows (show or hide them, depending on the the image src (closed.gif / opened.gif)). Since I got a lot of rows I run over and toggle, the function takes some time to process and the browser "hangs" in the meanwhile. Due to this I want to show the user that the operation is still in progress and want to change the image of the link to a load spinner until it is finished. So I thought that I just have to change the src URL of the image in advance and then start the function, but jQuery is ignoring the line and I don't know why? Here is the code I am using:

$("a[name='changeDisplayModeAll']").click(function(e) {
e.preventDefault();
var newStatus;
var imageSrc = $("img[name='imageChange']").attr('src');

[Code]....

View 1 Replies View Related

JQuery :: Ajax Link - Segment Not Loading Page

Feb 8, 2010

$(document).ready(function() {
$('#main-content a').live('click', function() {
alert(this);
$('#main-content').load(this);
return false;
});});
Why is the above code segment not loading the page? When I replace this by an url it works correctly. The alert gives a correct url.

View 3 Replies View Related

JQuery :: Floating DIV With Label Loading For Ajax Request

Oct 27, 2010

I have a huge java script function which creates a div with a label Loading... for all ajax request. The script creates a div and appends to body , so the loading.. div appears on the top and it does not float when I scroll my page down. I want to use jquery to make the div float and show along with scroll.

Here is the code I use to create loading...div
if (!document.getElementById('busy-symbol')) {
busySymbol = document.createElement('div');
busySymbol.id = 'busy-symbol';
var busyLabel = document.createElement('div');
busyLabel.innerHTML = 'Loading ...';
busySymbol.appendChild(busyLabel);
document.body.appendChild(busySymbol);
Is there any simple jquery function I can call and it takes care of my div to float.

View 8 Replies View Related

JQuery :: Ready Event When Loading A Page With Ajax?

Apr 23, 2009

I am loading content into a page using the following: $("#someDiv).load("/Some.action",{id: someId}); The document that results from Some.action contains javascript at the top. I want the javascript to be executed when the resulting content is fully ready/loaded. I attempted to use the document ready:

[Code]...

View 2 Replies View Related

JQuery :: UI Tabs - Ajax Loading In Mozilla Firefox Only?

Jan 28, 2011

I built jQuery UI tabs with jQuery UI Accordion embedded into each tab. It works fine on my local machine, it also works fine on all browsers in the development server except using Mozilla Firefox.

[Code]...

View 2 Replies View Related

JQuery :: Loading An Ajax-powered Aspx Page?

Nov 10, 2010

I can obviously load an aspx page into a div container thru .load jquery function. But, if the aspx page is already enginereed to work with aspnet ajax (scriptmanager,etc) , this is lost and the first postback cause all the page to reload. My question is, how can I import an aspx page into a div, maintaining its own ajax functions ? In case it's not possible, what's the best way to get same result?

View 2 Replies View Related

JQuery :: BlockUI : Not Working When Html Page Is Loading Data?

Aug 9, 2010

I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area

>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG

[code]....

View 2 Replies View Related

JQuery :: Unable To Parse Fragment After Loading Html Via Ajax?

Feb 13, 2011

I am loading an entire page in ajax, but I just want to load a fragment from it. Using the .load() function, you can do this by adding a selector after your url like 'getPage.php #myDiv' etc, how to do it using the .ajax method.

I did some googling and found this solution:

$.ajax({
url: 'AjaxTest2.htm',
data: {},
cache: false,

[Code].....

I'm trying to get the "d1" div to be populated with the contents of the "my2" div on the second page. I don't want to use the .load() function, I want to use the .ajax() function. I can get this to work if I just use: $('#d1').html(data); instead of $('#d1').html($(data).find('#my2')); but the former results in the entire html contents of the second page being placed into the "d1" div, and I only want the fragement.

View 6 Replies View Related

JQuery :: Loading External HTML Pages Using .load() And Internal Is Not Working

Mar 16, 2010

I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:

<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>

Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:

[Code]...

View 5 Replies View Related

JQuery :: Duplicate Event Handlers, Loading Divs With Ajax, $('#div').load()

Apr 28, 2010

I'm loading a list of elements into mydiv with ajax, I want them to be selectable so I call the UI plugin selectable after the list has loaded.

The list building function produces this:

<div id='mydiv'>
<ul id='mylist'>
....
</ul>

[Code].....

The problem is, every time I click the link to reload the list via ajax, I get a duplicate selectable event handler created. Should I be removing the old event handlers before reloading the div ? if so, how?

Everything works, as in selectable still works, and only seems to fire once but I get ever growing memory usage in firefox and an ever growing list of event handlers in the firebug script tab. Eventually firefox starts to crawl and I have to restart the browser.

View 1 Replies View Related

JQuery :: Json Considered The Better File Format For Loading Data Via AJAX?

Aug 14, 2011

Is Json considered the better file format for loadind data via Jquery AJAX? I am going to use it either way, but from a cutting edge stand point, is JSON looked at a more cutting edge since it loads faster. 2. And for that matter is anyone using css3 and E4X? All these seem to require the latest versions of all browsers. Since my goal is to be cutting edge I was thinking to do some stuff in the above listed that require only the latest browser if it is detected, if not use what works in most all browsers? What are cutting edge web app developers really doing at this time?

View 2 Replies View Related







Copyrights 2005-15 www.BigResource.com, All rights reserved