JQuery :: Anchor Tag Is Not Working After Loading Ajax?
Dec 28, 2011I loaded the jquery ajax file in Div id:main_content, but in another div id:List <a> tag is not working. Both Div i loaded the the content as ul,li format.
View 1 Replies
ADVERTISEMENT
JQuery :: GalleryView - Loading Via Ajax Not Working?
May 6, 2010Using jQuery's plugin GalleryView http:spaceforaname.com/galleryview. I am able to get the gallery to load on a page refresh with $(document).ready(function(){
$('#photos').galleryView({show_panels: true,show_filmstrip: true,panel_width: 400,panel_height: 300,frame_width: 100,frame_height: 100});
});
I even tried that with the jQuery livequery plugin, which creates an infinite loop. I tried searching google for a solution, and only found one thread after extensive searching of people having the same issue of getting this plugin to work with ajax, but there was no solution. this is the thread
[Code]...
Ajax :: Loading Images In Interactive Way Not Working
Nov 19, 2010i have working with an aplication and like you can see, by clicking in a line at the right, each one displays a different image. When the image is loaded, there's a javascript code for re-measurement, for adjusting to the available screen area.but unfortunately the result is the image is loaded at its original size. The objImage.src is well retrieved from AJAX, like i can test with the alert: the getsrc.php?id="+img opens a MYSQL query on the database and returns the matching path to the img id, which is set before.
View 9 Replies View RelatedJQuery :: Anchor Tags Not Working In IE
Jan 14, 2010So I am creating a page with unordered lists housing a large range of numbers. I want to dynamically create anchor tags and write them in before each UL. In FireFox it works just fine, however; in IE7 the anchor tags won't work.
Here's my code:
$(document).ready(function(){
$("ul").each(function() {
var $li = $(this).find("li");
var $first = $li.filter(":first").text()
var $last = $li.filter(":last").text()
$(this).before('<a name="'+$first+'"> </a><span>' + $first + ' - ' + $last + '</span>');
$('#lists').prepend('<span><a href="'+$first+'">'+ $first +'-'+ $last +'</a> | </span>');
});
});
Jquery :: Class In Anchor Tag Isn't Working
Aug 19, 2010I used the following jQuery in my application
Code:
$(document).ready(function(){
$(".example7").colorbox({
width:"50%", height:"65%", iframe:true
});
});
Now my requirement is... I have to set this to a button but through javascript.. so... in javascript i used this as
[Code]....
JQuery :: Bind Click Event To Anchor Tag Not Working
Jul 16, 2009When I load the page the div #forgot_login blindes down even though I did NOT click the anchor link. Also, clicking the anchor link does not toggle it up and down. The event binding is not working.
HTML
<a href="#" id="forgot_login_link" title="Show">Show</a>
jQuery Event
$("#forgot_login_link").click(show_hide($("#forgot_login")));
Here is the show/hide code:
function show_hide(p_Element) {
p_Element.toggle('blind', { direction: "vertical" }, 500);
}
JQuery :: Click Function Of Anchor Tag Not Working With Href Other Than #?
Jul 25, 2011I started with the simplest step - the hide() function:
$(document).ready(function(){
$("a#p").click(function(event){
$("#HiddenDiv").hide();
})
});
It worked fine as long as the href attribute of the anchor tag was '#'. Then I tried using href other than '#' and ran into a problem. I just changed the href to:
<a id="p" href="test.php">Click me</a><br />
<div id="HiddenDiv">Testing mate</div>
test.php is the page in which both these sections (html and jquery) are present, so like a postback to the same page.
This method didn't work and on clicking the anchor tag, the div stayed visible.
I then tried theevent.preventDefault(); method and that worked.
So I experimented more. I tried using the hide function on a dynamic link, something like test.php?a=1.
I ran into a problem again. The div remained visible on clicking that link.
AJAX :: IE8 Not Rendering - Unhide A Div With An Animated Loading Icon - Then Hide It Again When Loading Is Complete
Aug 26, 2010Im trying to add some simple display features to a web application and am running into some unexpected IE8 behavior. Basically, the app runs some database retrieval from the server using Ajax techniques, and during that time (say, 30 seconds), I want to just give the user a clue as to whats going on. It could be as simple as a wait cursor. More interesting, I prefer to unhide a div with an animated loading icon, then hide it again when loading is complete.
[Code]...
JQuery :: Simple Fading DIV Test Not Working - Anchor Tag Null?
Sep 8, 2009I'm doing some simple tests and I can't get this to work on a wordpress site. Basically I'm trying to fadeOut a div with id of "box" when a link is clicked. I mentioned Wordpress because the head code is loaded dynamically into the page template, as well as the body content. I wasn't sure I this made a difference in diagnosing the problem. When I load the page, Firebug keeps giving an error...
$('a') is null
Here is my stripped html code...
<head>
<script src="[URL]"
type="text/javascript"></script>
<style type="text/css">
#box {background-color: red; width: 300px; height: 300px;}
</style>
<script type="text/javascript">
$(function() {
$('a').click(function() {
$('#box').fadeOut();
});
});
</script>
</head>
<body>
<div id="box">
</div>
<a href="#">Fade Out</a>
</body>
JQuery :: Reload Page With Anchor When Anchor Link Is Clicked?
May 26, 2011I need to get the page to reload with the anchor in the link when it is clicked in a dropdown menu. For example if I am on 'www.domain.com/about/#2' and I then click on 'www.domain.com/about/#3' the url changes but the page doesn't reload so I need the page to reload, but keep the new anchor (#3).I gave the links with anchors a class of 'reload' and tried this:
$('a.reload').click(function() {
window.location.reload();
});
Onclick Not Working In Anchor Tag To Autofill An Input Box?
Apr 6, 2010I am trying to autofill a box by clicking a link (with return false). The function to autofill works with button tag but not in anchor tag - instead of returning false, the click event transitions to the href.
Here is the simplified code.
<!DOCTYPE html PUBLIC"-// W3C//DTD Xhtml 1.0 Strict//EN"" http://www.w3.org/TR/xhtml2/DTD/xhtml1-strict.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en">
<head>
[Code].....
Onclick Not Working In Anchor Tag To Autofill An Input Box / Sort It?
Apr 6, 2010I am trying to autofill a box by clicking a link (with return false). The function to autofill works with button tag but not in anchor tag - instead of returning false, the click event transitions to the href. code...
View 2 Replies View RelatedJQuery :: JCarousel Only Working On Second Loading
Sep 9, 2010I am using jcarousel for a scrollable list of images (vertical). Unfortunately, when you try to scroll it the first time you enter the website its not working properly. Just when you try to visit the site the second time it the scrolling will work as intended (when cache deleted, again, it will not work). [URL]. To load the script earlier, I tried to already put it in the head of the index page (starting page), but this had no effect. The Problem is for IE and Firefox the same. I am using Dreamweaver CS4.
View 1 Replies View RelatedJQuery :: Ajax Loading In The Same DIV 1 Time Yes And 1 Not?
Jan 6, 2010You need the link to be out side the div you are loading your content into. As the line "$('#wrapper_of_subpages').load(this.href + " #wrapper_of_subpages");" in your code don't copy the event with the link you need some other way to keep your link event.
View 4 Replies View RelatedJQuery :: AJAX Only Loading One Time In IE?
Oct 19, 2011I am working on a page which uses a JQuery AJAX to call another php page that displays a list of random items and reloads every 2 seconds. The below code works in Chrome and FF but only once in IE,
[Code]...
JQuery :: Ajax For Loading Drop Down Menus?
Sep 6, 2010I've used the ajax function to load in data like "click the submit button, ajax executes output.php and throws in back into a div tag in theform.php."
But what if I have a multiple dropdown menus that submit the form and need to be reloaded depending on the previous dropdown menu's value? How would I set up the ajax so those are loaded without a refresh?
JQuery :: Ajax Loader To Appear In Between Page Loading
Aug 19, 2009I'm creating a site using AJAX and I would like for an ajax loader to appear in between the page loadings.
$("#menu ul li").click(function(event) {
$("#ajaxLoader").show(function(){
alert('hello');
});
setTimeout("jQuery.fn.test("about");", 3000);
});});
jQuery.fn.test = function(page) {
$("#content").load(page + ".html");
$("#ajaxLoader").hide(function(){
alert('good bye');
});};
This works perfectly the first time - the ajax loader appears for about three seconds before disappearing and instead the page is displayed. But the second, third, fourth ... time, the ajax loader never shows up.
JQuery :: Using Tabs And Loading Content By Ajax
Sep 21, 2010I use tabs, loading content by ajax. When I click on a tab, on first load, any access to objects like:
$("#my_input_text").val('my value')
Works fine, but if a click on another tab, and click again to theprevioustab, the same code don't update the input text.I think that is because the document has 2 inputs with the same id after second refresh.
To prove this, I did, on javascript console of firebug:
document.getElementById('my_input_text').id = "bad_my_input_text";
and$("#my_input_text").val('my value')
works again. Exist some way, when click on a new tab, before load a content, clean all data from previous tab?
AJAX (jQuery) Loading Images Blindly
Oct 20, 2011I've got image files named 0-0, 0-1, 0-2 and so on up to a certain point, and I want to load each file until it can't find another, hence the jquery ajax error. At the moment, this works in firefox only.
Code:
for (var i = 0; i < _images.length; i++) {
var ready = 1;
var count = 0;
var arr = [];
[code]....
JQuery :: Loading Image Before Operation Starts Not Working?
Jun 16, 2009i have following problem: When the user on my website presses a image link, I prevent the default behaviour, and toggle some table rows (show or hide them, depending on the the image src (closed.gif / opened.gif)). Since I got a lot of rows I run over and toggle, the function takes some time to process and the browser "hangs" in the meanwhile. Due to this I want to show the user that the operation is still in progress and want to change the image of the link to a load spinner until it is finished. So I thought that I just have to change the src URL of the image in advance and then start the function, but jQuery is ignoring the line and I don't know why? Here is the code I am using:
$("a[name='changeDisplayModeAll']").click(function(e) {
e.preventDefault();
var newStatus;
var imageSrc = $("img[name='imageChange']").attr('src');
[Code]....
JQuery :: Ajax Link - Segment Not Loading Page
Feb 8, 2010$(document).ready(function() {
$('#main-content a').live('click', function() {
alert(this);
$('#main-content').load(this);
return false;
});});
Why is the above code segment not loading the page? When I replace this by an url it works correctly. The alert gives a correct url.
JQuery :: Floating DIV With Label Loading For Ajax Request
Oct 27, 2010I have a huge java script function which creates a div with a label Loading... for all ajax request. The script creates a div and appends to body , so the loading.. div appears on the top and it does not float when I scroll my page down. I want to use jquery to make the div float and show along with scroll.
Here is the code I use to create loading...div
if (!document.getElementById('busy-symbol')) {
busySymbol = document.createElement('div');
busySymbol.id = 'busy-symbol';
var busyLabel = document.createElement('div');
busyLabel.innerHTML = 'Loading ...';
busySymbol.appendChild(busyLabel);
document.body.appendChild(busySymbol);
Is there any simple jquery function I can call and it takes care of my div to float.
JQuery :: Ready Event When Loading A Page With Ajax?
Apr 23, 2009I am loading content into a page using the following: $("#someDiv).load("/Some.action",{id: someId}); The document that results from Some.action contains javascript at the top. I want the javascript to be executed when the resulting content is fully ready/loaded. I attempted to use the document ready:
[Code]...
JQuery :: UI Tabs - Ajax Loading In Mozilla Firefox Only?
Jan 28, 2011I built jQuery UI tabs with jQuery UI Accordion embedded into each tab. It works fine on my local machine, it also works fine on all browsers in the development server except using Mozilla Firefox.
[Code]...
JQuery :: Loading An Ajax-powered Aspx Page?
Nov 10, 2010I can obviously load an aspx page into a div container thru .load jquery function. But, if the aspx page is already enginereed to work with aspnet ajax (scriptmanager,etc) , this is lost and the first postback cause all the page to reload. My question is, how can I import an aspx page into a div, maintaining its own ajax functions ? In case it's not possible, what's the best way to get same result?
View 2 Replies View RelatedJQuery :: BlockUI : Not Working When Html Page Is Loading Data?
Aug 9, 2010I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
