JQuery :: Show Loader While Loading Large Amounts Of Data?
Oct 1, 2009
I am having a little problem trying to show a loader (An animated GIF) while some request to a database happens. I have a page where the user selects a YEAR and when they select it with AJAX I perform a request to a database to get all the values for that specific year.
The problem is that there is a lot of information (4000+ records) that I need to query and show in a table (Actually I didn't use a table I use DIVs that look like a table), and when the user selects the year the webpage freezes for about 5 seconds and then it loads all of the data.
Is there a way to sort of show an image loader gif while the data is being gotten? I tried putting the loader image in the DIV container while no year is selected and then once the request is done, I substitute the DIV container's contents (The image loader) for the data from the database.
[Code]...
View 1 Replies
ADVERTISEMENT
May 22, 2009
We are using jQuery JavaScript Library v1.3.1 for paging and sorting purposes. This library is working fine when we are loading smaller
data sets (<1000 records) on the page. However, when data set starts getting large (>3000 records), the initial page gives a script loading
error and the page does not load at all.
View 1 Replies
View Related
Aug 19, 2009
I'm creating a site using AJAX and I would like for an ajax loader to appear in between the page loadings.
$("#menu ul li").click(function(event) {
$("#ajaxLoader").show(function(){
alert('hello');
});
setTimeout("jQuery.fn.test("about");", 3000);
});});
jQuery.fn.test = function(page) {
$("#content").load(page + ".html");
$("#ajaxLoader").hide(function(){
alert('good bye');
});};
This works perfectly the first time - the ajax loader appears for about three seconds before disappearing and instead the page is displayed. But the second, third, fourth ... time, the ajax loader never shows up.
View 2 Replies
View Related
Nov 26, 2006
Does anyone know of a Javascript that will show an amount in a drop down based on what was selected in the previous drop down? Example: Code:
<select id="car">
<option value="volvo">Volvo</option>
<option value="audi">Audi</option>
</select>
<select id="price">
<option value="">Please select</option>
<!-- show this if volvo -->
<optgroup id="vol">
<option value="30000">30000</option>
<option value="31000">31000</option>
</optgroup>
<!-- show this if audi -->
<optgroup id="aud">
<option value="40000">40000</option>
<option value="41000">41000</option>
</optgroup>
</select>
View 9 Replies
View Related
May 19, 2010
I'm working on a project that involves a page with a large amount of images (sometimes 400+). What's the best way to handle this? Should I track the loading-state of all of them, or is it save to assume I can do stuff as soon as the last image is loaded? So.
[Code]...
View 3 Replies
View Related
Oct 29, 2010
I have a coldfusion data component that receives two arguments and runs a stored procedure and returns a large data set. I want to use a textbox with autocomplete its data is that result set. I do not want to convert the result set to an array for performance.
View 1 Replies
View Related
Dec 5, 2010
I was looking for JQuery Grid which will help me more than 1000 - 2000 records. I mainly need search and paging .
View 1 Replies
View Related
Oct 13, 2009
I'm requesting a very large JSON dataset for a table via AJAX and I'm building it on the fly with JQuery. What would be the most efficient way to build it?
View 2 Replies
View Related
Jan 30, 2011
I have a webpage with a left navigation bar and a content box with thumbnails in. I would like to be able to click one image and have all the thumbnails hide and show the larger version of the image in their place.
View 4 Replies
View Related
Apr 5, 2007
Here's the situation: I have a simple php file which retrieves data from a
mysql database and displays it in a table. However, the number of records
has gotten so large that retrieving all the data takes a lot of memory and
the browser freezes.
I been googling for a solution and some1 mentioned something called live
scrolling where the data is retrieved only when you scroll up or down.
Since am just an amateur and not familiar with XML, XSL, etc; can any1
recommend some link where i could find some JS script with such a feature?
one that's easy to get started with if possible...
View 4 Replies
View Related
Nov 5, 2007
I have a table I am populating with data from a DB, and have it
sortable on the client side. When the table exceeds around 300 rows,
I start running into problems with rendering and sorting it. I
started out using Prototype to help with the sorting, but it appears
that this results in a lot of calls to _getElementsByXPath, which are
taking up a large percentage of the rendering time. I believe this
call is occurring as the DOM is being parsed.
What is the general/most accepted manner of dealing with large data
sets (I am expecting some to grow into the thousands) in a table so
that it can be sorted client side? I am thinking of building a
javascript (JSON) object containing the data, and sorting based on
this. Anybody have any thoughts on this approach, or any suggestions
for other ways to approach this?
View 2 Replies
View Related
Jul 6, 2011
I am in the process of creating a site for real estate listings optimized for a mobile environment. One of the features that is desired would be a google map that loads listings as the user drags. One of the catches to this is that very few listings have included latitude and longitude values. Therefore, every time I need to add a listing to the map I first need to geocode it. Now with a few listings this is not really a big deal. However, the end goal would be to show all listings within the current bounds.Which depending on the zoom level could be anywhere from a hand full to several hundred.owever, when I attempt to load say 100 listings to the map it pretty much freezes and is fairly buggy after wards.
That said I was wondering if there is a better way to handle this. Perhaps submitting the listings as places with a CRON and having markers generated automatically? I am just trying to think how I can achieve this in a way which doesn't kill a mobile phone because it seems impossible considering there could be over 5000 listings in bounds of the map area. The only real solution I have is to only show say 30 or so and use pagination for the next 30 and so one within bounds.The ultimate goals is when the map bounds change ALL listings will show up within that bounds. The way I have currently approached this is that when the user stop dragging the map a asynchronous request pulls in ALL listings within bounds as an XML those full addresses are geocoded and added to the map. However, this is wrecking havok on the browser and I am not even going to try it in a mobile environment considering its dragging a desk top down. I'm thinking this is less and practical and pagination has to be used but perhaps someone out there has dealt with a similar objective.
View 1 Replies
View Related
Oct 11, 2010
I am using Ajax to send a large text box to a server script, however, when the textbox has a lot of data it fails. Is there a better way for me to do this? Here is my code.
Code:
<script type="text/javascript">
function testmail()
{
if (window.XMLHttpRequest)
{// code for IE7+, Firefox, Chrome, Opera, Safari
[Code]...
View 7 Replies
View Related
Dec 13, 2011
I've been using localStorage to store a large amount of data (> 5mb). I know that most browsers limit localStorage to 5mb. However, on the specification site it states,
Quote:
User agents may prompt the user when quotas are reached, allowing the user to grant a site more space. This enables sites to store many user-created documents on the user's computer, for instance.
Is this available yet? If so, how would I use it?
View 3 Replies
View Related
Sep 16, 2009
I am building a large registration form. In this form, a sponsor/educator must register himself or herself and then may add up to 6 more " delegates" in pairs. The first two pairs registration info on the form is shown by default. I need to hide the other two pairs until when/if the user clicks on a button to add two more delegates at a time. I used javascript to show or hide the parts of the form that I had put into two divs and adjusted the css display attribute. However, my problem was that, if the user filled out the sponsor/educator section and the first two delegates, and then decided to add two more, when the user clicked on the button to show the part of the form for delegates 3 and 4, it reset all the previous visible form fields to empty. Not good. So, I thought, maybe AJAX.
I created the request object (I am a relative novice at AJAX), had it grab a text file with the code to insert into my target div, in this case a div with id = "delegate3and4". Surprisingly however, it still reset the previous form fields to empty. Am I misunderstanding how AJAX is supposed to work? I figured that, because it does not refresh the page that this would not happen. In fact, to test this out, I created a simple page from scratch with just a single input field and then used AJAX to insert the file in a div after this field and it did not reset the previous input. So, I am totally confused about why this would be happening on my live page. The page is a php page as it submits the form to a php script for processing but I don't think this should make a difference.
View 3 Replies
View Related
Oct 12, 2010
Using an external Javascript file associated with an HTML file. I was just curious how I could convert the above code into a workable Javascript code. There is a Calculate button on the HTML page so I need to use a calculate_click function I know. I have included the HTML and CSS I just need help writing the Javascript portion.[code]
View 4 Replies
View Related
Jul 16, 2009
I am needing an accordion with dynamic data loading on each tier.
View 1 Replies
View Related
Aug 11, 2010
Apologies if this is a fairly simple question! I'm fetching data (from a MySQL database), and would like to show an animated loading image while the data is being downloaded, and obviously then hide it when the data is fully downloaded. I've found plenty of tutorials describing how to achieve this is the other direction (i.e. when submitting a form) but I'm not sure how to adapt these to what I want.
View 2 Replies
View Related
Jan 12, 2011
i had created a test page for showing a grid for a task demo. I am supposed to fill it with dummy data for now.i have been using jqgrid for quite some time and many of the pages are working on some live projects also,but today i was unable to populate the data from an array.i have created a test script for you people to see, here also i am facing the same problem, i dont remember what all was required to fill it as it has been quite some months since i worked on jquery.this is the link for the test page
View 2 Replies
View Related
Aug 5, 2009
I recently set up a JQuery script to show and hide a specific DIV on my site. Everything is working correctly except when the page is loading, the DIV is fully expanded and hides as it's supposed to a few seconds later. Ideally, I would like this DIV to remain hidden until the user actually clicks on it. This seems to be a performance issue, but honestly I am a JavaScript novice so I really don't know where to go from here.
The page in questions is here. And the specific areas that use this script are the "Change Log" and "Readme" boxes.
View 1 Replies
View Related
Sep 8, 2010
I have a button on my site, which when clicked calls an ajax function. What I want to do though, is append a loading graphic for just 2 seconds inside the button such that it looks as if the website is 'busy' saving when the button is clicked. This is obviously just for user feedback as the 'save' is done instantly - it's just for user feedback to make the user confident that the save button has worked. To do this, I'm trying to append a loading image to the save button, delay for 2 seconds, then remove the image, but it doesn't seem to work.
I have this HTML:
<p><a href="#" title="" class="save">Save</a></p>
And this jQuery:
$
(
[Code]....
View 1 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Sep 4, 2010
I'm not sure how to make something draggable which is dynamically loaded. The click event works fine on the new content though.
Like for example [code]...
View 4 Replies
View Related
Apr 11, 2011
I am using jquery autocomplete combobox I load more than 25000 data. I set
minLength:3, delay: 700,
When I start typing three characters, in the third character ie8 shows the "Stop running this script" how to handle this huge amount of data
View 1 Replies
View Related
Aug 14, 2011
Is Json considered the better file format for loadind data via Jquery AJAX? I am going to use it either way, but from a cutting edge stand point, is JSON looked at a more cutting edge since it loads faster. 2. And for that matter is anyone using css3 and E4X? All these seem to require the latest versions of all browsers. Since my goal is to be cutting edge I was thinking to do some stuff in the above listed that require only the latest browser if it is detected, if not use what works in most all browsers? What are cutting edge web app developers really doing at this time?
View 2 Replies
View Related
Apr 13, 2011
Can anyone teach me on how to use this script? (im not a programmer )
i wish to use this but the images are in each div code...
View 1 Replies
View Related
