Loading Js Code With Xmlhttp Working (but..)
Jul 23, 2005
i want to postload javscript from another javascript. This works fine in
firefox and IE6 for macIE i can use an Iframe to load the code and inject it with insertAdjacentHTML The problems arise with safari and opera. Both load the new code with XMLHttpRequest, but the code is no 'executable'
To make this possible on IE i had to use the magic 'DEFER' attribute.
(Sync or Async ist not the issue)
This is a extract of the working code:
View 5 Replies
ADVERTISEMENT
Jul 26, 2005
Using XMLHTTP and DOM I'm able to load new HTML page content.
I'd now like to load small snippets of javascript with the HTML markup
and have that <script> incorporated into the page. If any of the loaded
script exists outside a function definition (eg: a call to a function),
I'd like that code to be executed as soon as its added to the DOM.
Can anyone suggest the best way to do this? I've Googled but not found
anything comprehensive. Do I need to use the eval() method or is there
a better way?
View 10 Replies
View Related
Mar 3, 2009
All Code Working fine in Firefox and Google Chrome, But in IE nothing happened Ajax Function IN MAIN PAGE
<script language="javascript">
var xmlHttp
function showBabyId(str)
{
xmlHttp=GetXmlHttpObject();
[Code]...
View 4 Replies
View Related
May 6, 2007
I wrote an "ajax" script that pulls dynamic content into a div container via xmlhttp. There is a variety of lists on this page that are all ajax. Basically the up/down arrows in the Music, Photos, Users, Community etc boxes have this javascript funtion that replaces the innerHtml properties of a div to some response data from an asp.net object.
In IE these up/down arrows works fine and pull in data, but in FireFox the divs come up with "Undefined" in the div instead of the data.. Code:
View 3 Replies
View Related
Jun 4, 2009
want to get the alert on responce text, but getting nothing, my code is as follow,
<?php session_start(); ?>
<script type="text/javascript">
var xmlHttp
[code].....
View 9 Replies
View Related
Dec 9, 2004
I have a javascript that is supposed to read a text file (a log from a php script) and it should be shown in a html page. Even more, it should read that txt file again every 10 seconds and update the result every time on the page.
I use xmlhttp for this, after a suggestion from someone on this forum. My script is working well, but only the first time the page is loaded. From then on it becomes unrelieable and I dont know why.
This is the first part: loading a function in the body tag, and a browser version check, I dont think there is any problem in this.
Code:
<body onLoad="showbuffer();">
<script language="JavaScript">
<!--
var xmlhttp=false;
/*@cc_on @*/
/*@if (@_jscript_version >= 5)
try {
xmlhttp = new ActiveXObject("Msxml2.XMLHTTP");
} catch (e) {
try {
xmlhttp = new ActiveXObject("Microsoft.XMLHTTP");
} catch (E) {
xmlhttp = false;
}
}
@end @*/
if (!xmlhttp && typeof XMLHttpRequest!='undefined') {
xmlhttp = new XMLHttpRequest();
}
//-->
</script>
This is the second part, a self made looping function that looks up buffer.txt , and writes it on the page.
Code:
<script language="JavaScript">
<!--
function showbuffer() {
xmlhttp.open("GET", "buffer.txt",true);
xmlhttp.onreadystatechange=function() {
if (xmlhttp.readyState==4) {
buffertext=xmlhttp.responseText;
document.body.innerHTML= buffertext;
}
}
xmlhttp.send(null)
return false;
setTimeout('showbuffer()', 10000);
}
//-->
</script>
And this works, if I load my page then it shows exactly the content of buffer.txt . And if a bit later some data is added to the txt file, then it doesnt show up in the xmlhttp page , its still the same content as from the beginning so it didnt update. But there is something really weird about it, if I open up a second browser window and typ in the complete url of the buffer.txt file, and visit that page and look at the new data... then within 10 seconds the new part is added to the xmlhttp page. So the javascript function doesnt work, unless I refresh the page it is supposed to read. I've tried to mimic that, with a php script in crontab that would read buffer.txt through file(); or fopen(); every minute , but that didnt seem to work.
I dont think there is anything wrong with all the xmlhttp part of it, but rather with the way I try to integrate it into a loop. But this setup with setTimeout is the only way I know to make a function repeat itself with a few seconds delay after every step.
So, could anyone please point out how this could be solved ? Maybe another way to loop the xmlhttp part perhaps?
View 1 Replies
View Related
Aug 12, 2005
alert(xmlhttp.responseText);
gives a system error number: -1072896658
I have declared the object using
var xmlhttp = new ActiveXObject("Msxml2.XMLHTTP");
It works with IE version 6.0.2600 but not with IE version 6.0.2800
Couldnt find wat tis error code 1072896658.
View 1 Replies
View Related
Aug 8, 2010
want to learn javascript and i'm using ubuntu 9.04.i have google chrome and fire fox with enabled javascript. All things are good but when i write a js file and open it in browser but nothing happening html code loads but js not any hint why .
View 2 Replies
View Related
Mar 3, 2006
As we all know, JavaScript is client side and php is server side, (the php
code is 'allowed' to do stuff on the server that JavaScript cannot).
The problem with php is that it timeout after a while, (and the user also
has no clue as to what is going on for a long time).
I need to run a script on the server that could take a very long time.
So what I was thinking is mixing both JavaScript and PHP
Something like,
<script>
var endvalue = 1000; /* some number that the server can calculate
quickly */
var i = 0
while (i<=endvalue)
{
/**
call a php file that will do some work
somefunction.php?someNumber=i
*/
}
</script>
That way the server does the work, while the client keeps it going.
Ideally I would also get a return value/string from the php script.
View 9 Replies
View Related
Jan 12, 2010
I've run into a roadblock I just can't seem to get past. I'm developing a website for work (internal) and I have a lot of javascript calculations going on when someone enters data. What I want to do is to have a div apear when it begins calculating and goes away when it ends. I'm using:
// CSS code
div.loading-invisible{ display: none; }
div.loading-visible { display: block; ... various formatting here ... }
// Javascript
function calculate(evalForm) {
document.getElementById("loading").className = "loading-visible";
[Code]...
It works great in firefox. The div display appropriately, calculates, then disappears when it's finished. However, in IE it seems to want to calculate everything before anything is displayed. I placed alerts in the code to be able to pause it mid way and it worked. But without alerts it just hangs while everything is being calculated and the code for the loading screen just seems to cancel itself out. I attempted to put some waits in the code such as:
[Code]...
View 3 Replies
View Related
Aug 15, 2010
The thing is that I would like to stop pop-over (optin form) from loading on some pages (squeeze page,review pages etc.) and can't find a way to do that. We are talking about wordpress blog here... Is there a some kind of script or code I can use? Should be, it's not a rocket science. Just want to kill the process on some pages...I'm using popup domination [URL].
View 4 Replies
View Related
Sep 7, 2010
I recently found a really nice code that centers a page vertically: [URL].. What I like about it, is that when you zoom in with Chrome, nothing gets cut off. Normally other codes for centering will zoom straight into the middle, and cut off content on the left. The only problem I'm having with it, is that when the page loads in Chrome and Safari, it starts to load at the top of the page, and then quickly jumps down to where it's centered. It looks a little choppy when you're navigating through many pages. I'm wondering if there's a way to get it to load in the correct position where it will stay?
View 3 Replies
View Related
Aug 17, 2011
Ihave a list named'Geography', the list has a dropdown field called CountryDropDown, ID of this field is ID_CountryDropDown. This field is looking up to another list called LookUpCountry, which contains all the country names in the 'Title' Column.
[Code]...
View 2 Replies
View Related
Jan 6, 2010
I am using this fancy box code to smoothly pop up an image on click, I got it working on my main index page but that's not where I want to put it. My site has a menu where it loads external webpages inside the main index one, I would like to use the code on one of those pages but something is not working.
I have been told its a DOCTYPE issue but I am not able to use the specified DOCTYPE, however I find that it works all the same with my current DOCTYPE choice. If I use the given one in addition to the one I use now (and need) then my site does not work properly, further if I replace it I get the same results.
My existing doctype:
Code:
<DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd" "http://www.w3.org/TR/1999/REC-html401-19991224/loose.dtd" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
[Code]....
I even tried using the exact code from the example in that linked .htm page but it doesn't make a difference, it probably even hinders the code as it looks at the main html page. However loading the page on its own the code will work, so its related to the menu and the way that works.
View 2 Replies
View Related
Jan 3, 2010
I am using this fancy box code to smoothly pop up an image on click, I got it working on my main index page but that's not where I want to put it. My site has a menu where it loads webpages inside the main index one, I would like to use the code on one of those pages but something is not working.I am not able to use the specified DOCTYPE but find that it works all the same with my current one, however if I use the given one in addition to the one I have now (and need) then my site does not work properly, further if I replace it I get the same results.My existing doctype:
Code:
<DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"
"http://www.w3.org/TR/1999/REC-html401-19991224/loose.dtd"
[code]....
View 4 Replies
View Related
May 3, 2009
I am trying to create 3 boxes with 2nd select box content to be uploaded on the basis of value selected in first box and third box list should be uploaded on the basis of value selected in 2nd box.i have written coding for that as below but it is not working .
<html>
<head>
<title>Search Website</title>[code].....
View 1 Replies
View Related
Sep 14, 2005
I have following type of code in the header
function pre_load_pics()
{
if (document.images)
{
var image1 = new Image(400,265);
image1.scr = "pic1.jpg";
var image2 = new Image(400,265);
image2.scr = "pic2.jpg";
etc etc
}
and the following in the body
<script>
pre_load_pics();
</script>
but images are not downloaded until the app needs them later. Something wrong ? I thought they should be downloaded earlier?
View 15 Replies
View Related
Feb 23, 2009
I have a website that lists the movies I have on my computer and then when you click on a link for that movie, it retrieves information from IMDB. The code is in testing but for the most part it works.I was wondering if anyone knew why the following JavaScript would work on Firefox but not in IE. I develop on Linux, and I know there are IEs available for Linux, and I have used them before. I will be sure to track down the issue later, but from the resources I've been using, this should work in both major browser types (standards compliant and microsoft).The code is very dirty, and I have started an object oriented rewrite, but if I don't have the proper DOM skills for IE in this spaghetti code then I doubt anything is going to change putting it all into Objects.
JavaScript Code:
Original
- JavaScript Code
[code].....
View 1 Replies
View Related
Sep 9, 2010
I am using jcarousel for a scrollable list of images (vertical). Unfortunately, when you try to scroll it the first time you enter the website its not working properly. Just when you try to visit the site the second time it the scrolling will work as intended (when cache deleted, again, it will not work). [URL]. To load the script earlier, I tried to already put it in the head of the index page (starting page), but this had no effect. The Problem is for IE and Firefox the same. I am using Dreamweaver CS4.
View 1 Replies
View Related
Dec 28, 2011
I loaded the jquery ajax file in Div id:main_content, but in another div id:List <a> tag is not working. Both Div i loaded the the content as ul,li format.
View 1 Replies
View Related
Nov 19, 2010
i have working with an aplication and like you can see, by clicking in a line at the right, each one displays a different image. When the image is loaded, there's a javascript code for re-measurement, for adjusting to the available screen area.but unfortunately the result is the image is loaded at its original size. The objImage.src is well retrieved from AJAX, like i can test with the alert: the getsrc.php?id="+img opens a MYSQL query on the database and returns the matching path to the img id, which is set before.
View 9 Replies
View Related
May 6, 2010
Using jQuery's plugin GalleryView http:spaceforaname.com/galleryview. I am able to get the gallery to load on a page refresh with $(document).ready(function(){
$('#photos').galleryView({show_panels: true,show_filmstrip: true,panel_width: 400,panel_height: 300,frame_width: 100,frame_height: 100});
});
I even tried that with the jQuery livequery plugin, which creates an infinite loop. I tried searching google for a solution, and only found one thread after extensive searching of people having the same issue of getting this plugin to work with ajax, but there was no solution. this is the thread
[Code]...
View 4 Replies
View Related
Jun 16, 2009
i have following problem: When the user on my website presses a image link, I prevent the default behaviour, and toggle some table rows (show or hide them, depending on the the image src (closed.gif / opened.gif)). Since I got a lot of rows I run over and toggle, the function takes some time to process and the browser "hangs" in the meanwhile. Due to this I want to show the user that the operation is still in progress and want to change the image of the link to a load spinner until it is finished. So I thought that I just have to change the src URL of the image in advance and then start the function, but jQuery is ignoring the line and I don't know why? Here is the code I am using:
$("a[name='changeDisplayModeAll']").click(function(e) {
e.preventDefault();
var newStatus;
var imageSrc = $("img[name='imageChange']").attr('src');
[Code]....
View 1 Replies
View Related
Nov 16, 2009
Suppose,closing the browser through Browser Close Button(Top Right Corner cross(x) button), i have to execute some ASP script , for that, in body onUnLoad Event calling a fucntion called CloseWin(e,frm), it is working in Internet Explorer successfully , But in FireFox not working. how to solve this problem. or any other way to get the co-ordinates of browser close button( code for both IE and Firefox).
code follows
function CloseWin(e,frm)
{
//frm required for my program
var bButtonClicked = false;
[Code]....
View 1 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Nov 18, 2010
I download the jquery library, when i include it as such:
It loads but i always get some sort of error in the functions in the page or something...as if the js is loaded but not correctly or as if it's missing, even though the download itself is correct
If i change the include path to (which is the exact same file i downloaded):
Everything works fine i am thinking maybe it could be something that has to do with encoding maybe? am not sure...any clue? it's only happening with the jquery JS files, the rest are working fine.
View 9 Replies
View Related
