JQuery :: Data("page") Is Undefined
May 19, 2011I am working on Pinax (Django) and jQueryMobile, and I got this error:
Also, there is a javascript error: l.data("page") is undefined
ADVERTISEMENT
JQuery :: Get Xml Data Function Returns Undefined
Nov 22, 2011I am trying to make a function that will return part of some xml data, but It keeps returning "Undefined" here is the function, with the call:
Code:
function getUserInfo(u, t) {
$.ajax({
type: 'GET',
[code]....
Undefined Data In Javascript
Jul 20, 2005I have no idea why id is undefined in the arrow below:
<html>
<head>
<script type="text/javascript">
var id;
function window_onload()
{
id = "8888";
alert("ID = " + id);
}
</script>
</head>
<H2>Page 2</H2>
<body onload="window_onload()">
<P>id = <script type="text/javascript">document.write(id);</script> //<****
</body>
</html>
JQuery :: The "data" Parameter Is Always Undefined In The Success Callback In 1.5
Apr 13, 2011I have a really simple scenario which got broken after upgrading to 1.5.the defined handler for the success callback in $.ajax doen't set the data parameter - it's always undefined. This works fine in 1.4.4.
View 3 Replies View RelatedJQuery :: Retrieve Json_encoded Data But Getting "undefined"?
Jun 2, 2011have the following code that I thought I could retrieve json_encoded data but I'm just getting "undefined".The json_encoded string from the php array:{"table":null,"id":"2","itemCode":"1003","itemDesc":"Item infor for1003","itemWholesale":"1.99"}]I thought I could "grab" the name of each in the array and output the dataaccordingly. So on success of the ajax post (which does return data) I triedalert(itemData.itemCode); This is on line 10 in the below code snippet. Using this method returns "undefined" and NOT the data 1003 as I would expect.
jQuery Code:
$('#search_results tr').live('click', function() {
var $itemrow = $(this).closest('tr');
[code]....
JQuery :: Success - Error - Small Data Entry Screen - Post Form Data To A Page And Return A Message
Jul 22, 2011I am writing a small data entry screen that will post the form data to a page and return a message. But i cannot get the Success or Error functions working properly.
Here's the code where strData is the posted querystring of:
I'm not sure whether it should be in a form and using the onsubmit or click of a button.
JQuery :: .ajax And Page Refresh In Firefox - Can't Send Form Data In FF Without Page Refresh
Apr 15, 2010So my problem is that i can't send form data in FF without page refresh (though in IE7-8 everything works smoothly).
My code fragments:
JQuery :: GET Data From Another Php Page?
Oct 3, 2011i have developed a php based search page, that search from database and it has php based pagination,and from my index page, i am calling that search page using jquery into the resutlist div tag. it all works fine till now,but when i click on next of the pagination link, it took me to the search result page,what i want , is a way that the next href of search page (php pagination) to be called and show its result on the same div tag, without refreshing that page,,
[Cde]....
and on my search page, the next href pass some querystrings like [URL]
now, all i need is that the [URL] this link to be load into that resutlist without redirection or anythign else. remeber, the next link is on the search page, that is called asynchornously using jquery.
JQuery :: Data From Html Page To Another
Jul 27, 2011how can i get data ( a div) from an html page and put it in a different html page in a certain place? i can't get it to work !! i need something else i think!! i need it to load when i click on a link or a text am i missing something?? i've put the code in a click function but it doesn,t work...
[Code]...
Jquery :: .load To Get Web Page And XML Data
Oct 17, 2010Is it possible to use a .load or a .post or some other method to send a request to the server to update a page based on passed data and to return the updated html section and also to return an XML data structure back to the callback function in the .load method?I would assume at that point the load would load the #div section of the document to the target. If it is possible to send XML data also, how would I structure that and how would I send it and access it in jQuery or javascript?
What I want to do is update one section of the page with new html and then make some changes to another section using jQuery or javascript based on the XML data. Both changes are based on the data passed in the initial .load request so having to do it twice is redundant.
Passing Form Input Data From One Page To Another Without Control Of The Receiving Page
Jul 31, 2009I've been searching for a few hours and haven't been able to find a code snippet to see if this is available. I'm attempting to pass text from my website to another website that has a form setup on it. I'd like to fill in the pertinent data for my users on the page that I load for them. I cannot make any changes to the receiving page as it is run by another company. I've pasted some of the code that is available on the receiving form.
<script type="text/javascript">
//<![CDATA[
var theForm = document.forms['form1'];
if (!theForm) {
[Code]....
JQuery :: Passing Scroll Data To The Next Page?
Jan 5, 2010I couldn't find the fabled "bump topic link",
View 1 Replies View RelatedJQuery :: Extract Data From HTML Page?
Jul 11, 2011I stumbled across jQuery while during a search for my project that involves parsing and extracting content from HTML pages. I have a collection of xpath strings that identifies the data I would like to extract. Wondering if I could use jQuery for this purpose.
View 1 Replies View RelatedAJAX :: Update Part Of Page After Insert Data In Same Page
May 21, 2009I am currently programming Script Adds data to the database but if i want to Shown the data that have been added Requires refresh the page to show the Data that have been added . and I do not want this method.I want to when adding data to show updates as soon as the addition of data.This can be done by Ajax , and An example of this method used Google Gmail.
View 3 Replies View RelatedAjax :: Send 3 Data From One Page To Another Page Through .Request
Mar 24, 2009I am facing some problem with this when i am trying to sent the data in krnlAddComment1.asp page and there is only an insert query exists. after run the query successfully, response.write "...." revert back to me
if ((myname != null) && (comm != null) && (captcha1 == randomnum))
JQuery :: Select Element From Another Page For Processing Data?
Jul 25, 2011i have something questions. how can i select element from another page for processing data. ex : #myname.value from content.php and i will process that value to the process.php.
View 2 Replies View RelatedJQuery :: BlockUI : Not Working When Html Page Is Loading Data?
Aug 9, 2010I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
JQuery :: Dynamically Load Data Driven Html Page?
Jun 30, 2010So here is my problem...I've been banging my head against the wall for days with this one.How do you send data through the URL to be handled by a script in page.html, where page.html processes the data and dynamically displays the data in a modal. I can get the script to execute without trying to display in a modal, but as soon as I attempt to display in a modal, all I get is the static HTML without the jquery dynamic html.I know some code should be given, but if anyone could just walk me through the logic of why static html might be shown but not the dynamic, I think i can figure it out.
View 1 Replies View RelatedJQuery :: Import Data From Excel To SQL Server Web Page Without Uploading?
Jun 23, 2010Wantto import data from excel to SQL server from a web page, but wonder whether it is possible to do it without uploading the excel file from client's machine to server first.
View 4 Replies View RelatedJQuery :: Get Post Data From A Page Loaded In Iframe In Parent?
Sep 24, 2009How to get post data from a page loaded in iframe in parent page
View 1 Replies View RelatedJQuery :: Page Load Jumps To Top When Ajax Gets Data / Resolve This?
Feb 18, 2011I have a section at the bottom of one of my pages that gets data that can be further filtered by weeks. Users can click on any of the weeks to see the data that applies only to that week. This works just fine, but when the function finishes and replaces the html content of the div, the page jumps to the top so that the user has to scroll back down to see the results. I'd like to avoid that. [code]...
It's nothing terribly complicated. The 'weekSelection' links are disabled until a stakeholder is chosen, then they're good to go. The weird bit at the url variable is just some ASP.NET MVC stuff.The StakeholderForecasting div gets its contents replaced and all will be good as soon as I can maintain the page's position.
JQuery :: When Using .post(), Page Is Reloaded And Serialized Data Being Added To The URL?
Dec 24, 2010I'm trying to make an ajax post to some php and whenever the user clicks the submit button, it reloads the page and is adding the serialized data to the URL thus breaking the page and giving me an error that I do not have a person selected. I've tried adding "return false;" everywhere I can and it still doesn't work. Here's my code:
// EDIT CONTACT AJAX
$("editForm").submit(function() {
$.post("/ajax/edit-contact.php", $("editForm").serialize(),
function(data) {[code]...
// I've tried adding a "return false;" here and it doesn't work
}
// I've tried adding a "return false;" here and it doesn't work
);
// I've tried adding a "return false;" here and it doesn't work
Send Data From Page To New Page Only In Html?
Jan 19, 2011I want program code only using html and javascript. First I took one form and created some data on it like
name:xyz
address:hyderabad
country:india.
hobbies:reading,cooking.
submit button.Above is one simple form after submit i want it to display it in another page like out.html.
Displaying Data On Same Page Without Reloading Page
May 29, 2006I would the user of my website to click a link on a page and for some information to display on the page without a reload of the page. This is what I would like to happen in my specific case:The user clicks the name of the cd and the full track list and a small image displays above it, without going to a new page.
View 2 Replies View RelatedJQuery :: XML Looping Through Nested XML Document And Updating Page Elements Dynamically With XML Data?
Jan 26, 2010I have created two onClick events that i need to combine into one with jQuery. I am not sure how to do this.I have an unordered list:
<ul id="coverTabs">
<li class="currentTab"><a href="#">Individual</a></li>
<li><a href="#">Couple</a></li>
[code].....
JQuery :: Loop Through All Divs Where Class = AppStatus And On Each Iteration Pull Data From A PHP Page?
Dec 1, 2010I have a bunch of dynamically created divs which I need to loop through and then display text inside which is obtained via AJAX.
<div class="appStatus" id="appStat_1>TEXT FROM PHP PAGE</div>
<div class="appStatus" id="appStat_2>TEXT FROM PHP PAGE</div>
<div class="appStatus" id="appStat_3>TEXT FROM PHP PAGE</div>
Basically, I want to loop through all divs where class = appStatus and on each iteration pull data from a PHP page (via AJAX) to display in the DIV. I need to send the value after the _ of the id (which I can obtain using substring) with the AJAX request in order to return the correct text.For some reason.I know that I need to do something with
$("div.appStatus").each(function() {
)};
Just got myself lost in everything I tried.