Script Not Working In HTML Web Form / What To Do?
Mar 19, 2009
I am pretty new to coding (besides basic html), but I decided to start a new project in order to learn a little. I figured I would start with the basics Touching on PHP and Mysql. Anyways to get to the point.
Upon learning how to create databases and insert records in to a database via PHP. I decided to start working on a Form to create "users".
I am trying to accomplish the following code...
View 5 Replies
ADVERTISEMENT
Aug 6, 2009
Posting this in javascript because the problem might be caused by my scripting.
I made a 3 page long form using javascript, and the contents of the second page aren't submitted to the php script. link (http://rolstoel.dlnet.org/toevoegen.php?page=1)
View 4 Replies
View Related
Apr 16, 2011
My HTML with Javascript I had a problem with the form submittion.. where the javascript working fine for validation after completing validation my form submit is not processing to action specified in the form tag.
Here is the HTML Code
[Code]...
View 4 Replies
View Related
Feb 6, 2011
I would like to ask how do I get the value from a textbox from form.html which contains my iframe and copy the value into another page, test.html ?
View 2 Replies
View Related
Sep 15, 2009
I have a problem using span. here is my code
Code:
<html>
<body>
<form action="">
First name:
<input type="text" id = "firstname" name="firstname">
[Code]...
View 1 Replies
View Related
Aug 2, 2011
This seemingly simple line of code: jQuery('div#space-for-' + institutionId).html(data); works fine in Chrome and FireFox, but does not result in placing the "data" HTML content in the selected div. Nothing at all changes on the page when in IE8. I've tested in jQuery-1.4.2 and jQuery-1.6.2 with identical results.
View 1 Replies
View Related
Apr 30, 2010
why this
Code:
$('#div1').html($('.div2').html()); doesn't work in IE, but this does?
Code:
document.getElementById('div1').innerHTML = $('.div2').html(); both work fine in FF and others, but not in IE??????
View 6 Replies
View Related
May 2, 2010
Why my script is working in an HTML 4.0 doc but not in XHTML. When I have it in XHTML and click the reset button it does reset the form but not the table. If I have it in HTML doc it resets both the table and the form.
Here is my code for the form (the part that is affected by the reset.)
This is for a class and they are requiring it to be XHTML..
You can see the it here: [url]
HTML Code:
This is the actual button
HTML Code:
And here is the script
Code:
View 4 Replies
View Related
Jul 12, 2011
$(function() {
window.resizeTo(925,10000);
$('input').removeAttr('checked')
var feedback = "Your Results: ";
$(".yes").click(function () {var feedback = feedback + $(this).html();
$(this).parent().next("p").show("fast"); });
$(".no").click(function () { $(this).parent().next("p").next("p").show("fast"); });
[Code]...
View 3 Replies
View Related
May 16, 2011
I found jQuery simply amazing and been using this since then. My first and current version that I use is 1.4.2. My code below works fine in 1.4.2 until I upgraded to 1.6.1. I'm using CI for my php,btw.$("#ResultPanel").html(ajax_load).load("irs/login"+"#div_One"); After I upgraded to 1.6.1 Firebug reports "404 Page Not Found. The page you requested was not found". But when I switch back to 1.4.2 it works fine again. When I read the 1.6.1 release note it only says .attr() and prop() method nothing that I understand about .load().
my code that no longer supported in 1.6.1 released?
View 10 Replies
View Related
Oct 19, 2009
I have this function:
<script language="javascript">
$(document).ready(function()
{
$("#place").change(function()
[code]....
I does work fine on firefox.. but as normal on IE does not load the result form types.php... .html(data) is not showing up.
View 1 Replies
View Related
Jan 13, 2011
I'm using jQuery UI to enhance the look of my web app. One of my button has an Html.ActionLink in it. The Html should be returned as ananchor element. The button responds ONLY when the words in the button are clicked. If I click out side the words (but still inside the button) nothing happens. This is the jQuery code is:
$(".edit-button").button({ icons: { primary: "ui-icon-pencil"} });
I think I'm missing some jquery call to get the button to be connected to the html helper.
View 1 Replies
View Related
Dec 22, 2010
I am supposed to change the text of a <div> when the mouse is hovered above it. When the mouse leave the <div> tag the text has to get back to old text. What is happening is in mouseenter() if i give as $("div").html("<a href =>hello world</a>"); then the text of the div tag changes to hello world bith hyperlink but then when the mouse leaves the div then the mouseleave() event is not triggered. Instead of having the line mentioned above if suppose i have it as $("div").text("<a href hello world</a>"); then the text of div changes to the complete string in the quotes and the mouseleave() event is also triggered. I am supposed to render the html format so am i missing something or do i need to do something else.
View 1 Replies
View Related
Aug 23, 2010
I have an existing website I an trying to modify. In speedscript I have my include libraries and a veriable. Then I need to do an href with a link I have the code as follows <a href="WI_testweb/" + "custno" + ".xls">Matrix</a> The custno is the variable. Is there a way of doing this since the way I an trying is not working?
View 4 Replies
View Related
Feb 24, 2010
I have a search_result.php (attached herewith) at http:supertime2000.phpnet.us. and this is how it is queried from a search container in the homepage:
<div class="search_container">
<TABLE cellSpacing="0" cellPadding="0" border="0">
<TBODY><TR>
[code]....
View 3 Replies
View Related
Nov 15, 2010
It invovles changing the html using jQuery when the browser is less than IE9
I was messing with the .html() jQueryfunctionthat Ihaveused before and was having some problems With this code, it runs in all browsers:
<!DOCTYPE html>
<html lang="en">
<head>
<meta charset="utf-8" />
[Code]....
View 1 Replies
View Related
Oct 15, 2009
It's not working.
<FORM METHOD="POST" on click="java script:window.location.href='exporttoexcel.jsp ">
<INPUT NAME="Results"TYPE="submit" VALUE="Export to Excel">
</FORM>
Asp file:
<%
Response.ContentType = "application/x-download"
Response.AddHeader = ("content-disposition","attachment;filename=Test.xls")
%>
View 4 Replies
View Related
Aug 25, 2010
I got an ajax that creates an image tag whenever a drop down for car brand is clicked, it works well in firefox and internet explorer, but doesn't show on safari and chrome The ajax:
[Code].....
View 1 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Oct 20, 2010
I've used to an AJAX call to load a HTML table into div. This is working successfully. I know want to use a click event on buttons located within the inserted table.
The click event is triggering on buttons outside the inserted table but not on the buttons within the table.
Do I need to call some sort of refresh function to so that jQuery is able to pick up these events?
View 1 Replies
View Related
Aug 8, 2011
I have a <Html> Table with so Many <li> elements. SO when I export the html table to excel the cells are incrementing when ever it encounters <li> I want them to increment only when they encounter <th><td> Here is my jquery
[Code]....
View 2 Replies
View Related
Oct 19, 2010
i am doing the JavaScript code But my code is not running please have a look onc code sirnow i am trying the button click then not workingMy Code is BelowPage.html
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml">
[code]....
View 5 Replies
View Related
Aug 24, 2009
How to Make a Html Form Shows Up when Visitor Click a Link.. I have seen Site where you want to add Message u click Link then the Form under the Link Shows Up .. it stays Hidden unless Visitor Click Link 'Send Message'. It seems done by Java but How ..
View 10 Replies
View Related
Mar 16, 2010
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
View 5 Replies
View Related
Aug 6, 2010
[URL]If you go to that site on Firefox, the "Return Code #" expands. But if you use IE, you'll see that it doesn't.I could add a fix in there for the fields if they were static, but if you see my javascript, they are dynamically loading fields.
This "class":"wide" is not working:
Code:
invoiceInput.appendChild(createElement("input", {"type":"text", "name":"invoice[]", "size":"8", "class":"wide;"}));
I am using a script I found on a jQuery board [URL] and it works for them, but not for me because my syntax is probably wrong. And they also are just using 1 field and not near-unlimited dynamically loading fields like I am.How would I add in a fix to have the browser 'only' use the expansion if the user is using IE6 or IE7?
View 1 Replies
View Related
Aug 6, 2010
[URL]...If you go to that site on Firefox, the "Return Code #" expands. But if you use IE, you'll see that it doesn't. I could add a fix in there for the fields if they were static, but if you see my javascript, they are dynamically loading fields. This "class":"wide" is not working:
Code:
invoiceInput.appendChild(createElement("input", {"type":"text", "name":"invoice[]", "size":"8", "class":"wide;"}));
I am using a script I found on a jQuery board [URL]..and it works for them, but not for me because my syntax is probably wrong. And they also are just using 1 field and not near-unlimited dynamically loading fields like I am. How would I add in a fix to have the browser 'only' use the expansion if the user is using IE6 or IE7?
View 3 Replies
View Related