JQuery :: .mouseleave() Not Working With .html() In Mouseenter()?
Dec 22, 2010
I am supposed to change the text of a <div> when the mouse is hovered above it. When the mouse leave the <div> tag the text has to get back to old text. What is happening is in mouseenter() if i give as $("div").html("<a href =>hello world</a>"); then the text of the div tag changes to hello world bith hyperlink but then when the mouse leaves the div then the mouseleave() event is not triggered. Instead of having the line mentioned above if suppose i have it as $("div").text("<a href hello world</a>"); then the text of div changes to the complete string in the quotes and the mouseleave() event is also triggered. I am supposed to render the html format so am i missing something or do i need to do something else.
View 1 Replies
ADVERTISEMENT
Apr 3, 2011
I have a div (container_div) with 2 smaller div inside: one containing an image (image_div), and one containing some text (text_div). I want to start an animation on image_diveverytime the mouse is over the whole container_div. The animation works fine as long I use firefox or chrome; on IE insteadthe mouseleave event is triggeredeach time the mouse passes over the text inside text_div (not the entire div, only the text).
I tried to put the text directly inside container_div but it was unuseful; I created an empty div (trigger_div) as big as container_div, I putted it exactly over container_div and gave it a higher z-index value, then I associated the mouseenter/mouseleave event to this div but I obtained the same result: on IE (and only in IE) the text contained in text_div trigger the mouseleave event.
I know that I could use some images to emulate text and avoid the problem, but I want to use text for search engine optimization.
View 1 Replies
View Related
Apr 11, 2009
I am looking for a way to simulate the actions of the hover (or mouseenter/mouseleave) whilst using the live method of binding (The items are dynamic). Is there a way to do this or will I need to use the 'old fashioned' method of unbinding and rebinding? I do not want to use a plugin.
View 6 Replies
View Related
Nov 11, 2011
My design involves two "layers". On the first layer, I have a circle, with some links in the middle. This is just a div with a background image, and some text in the center. Then I have another circle, same size and shape, on top of the first one, covering it up. This circle just has a one or two word title on it. When a user hovers over the title with their mouse, I want that div to disappear, showing the links underneath it. When you mouse out, the circle with the title should show back up.
Here is the basic HTML:
[Code]...
So what happens, is if you mouse over, the circle fades away just fine. But if you move your mouse at all again, even the slightest bit, the event is triggered again. So the title fades in and then out again real quick. Even if you actually mouse completely out of the CircleTitle div, it still triggers one last time instead of just fading in.
Because mouseenter keeps track of the mouse being over that element, and then that div disappears, it's probably causing some problems. But I don't know any other way to get this to work! If someone has some ideas,
View 3 Replies
View Related
Apr 5, 2010
I am trying to display content when mouseenter the div tag with id="test" when mouseleave i want to hide the contents.It was working fine only once. I want it to repeat that when ever mouseenter or mouseleave.Test1.txt contains - just text
<html>
<head>
<style>
[code]....
View 2 Replies
View Related
Jul 16, 2010
I have serveral DIV-Containers on my site and I added to each an .mouseenter and .mouseleave event:
$(document).ready(function()
{
$('div.Menu').mouseenter[code]...
It works fine but the problem is, if I move the mouse over and over the DIV-Containers the animations runs, and runs, and runs.I think, each time I move over the DIV, the animation is going to the Queue and runs that often. I want it to stop after the .mouseleave animation is finished, so that it runs just on time..
View 2 Replies
View Related
Jul 28, 2011
i'm having the following problem: when i move my mouse on the right scrollbar to scroll down the page.. then the mouseleave event is triggered.. i tried adding it to the document also... but it gives the same output.
If i hover the scrollbar in firefox then it doesn't trigger..
how to fix this in google chrome? or is this a possible bug?
$(window).mouseleave(function() {
alert("trigger");
});
View 2 Replies
View Related
Jun 19, 2010
[url]
I have an idea to implement this type tabs. These tabs page is download from Internet.
I would like to modify this content.
1) Major problem is IE7 and Firefox are supporting but IE6 not supporting.
2) Actually these vertical tabs will come when I mouseover that tab. But I don't like this.
My condition: When I press Mouse left button only that should come.
[url]
View 1 Replies
View Related
Nov 18, 2010
I want an action to fire ONCE on mouseenter. How do I keep the action from repeating ad nauseum?
It's a <td id="cap"> with an image. An alternate <td id="capB"> placed on top of it (via z-index) is supposed to momentarily become display:inline and show its image, then goes display:none again and the original <td id="cap"> becomes visible again until mouse goes out and re-enters.
But the problem is, my script keeps refreshing and thinks it's repeatedly a genuine mouseenter, so the whole thing triggers endlessly.
How to I stop the action's repeat unless a real "user made" mouseleave and mouseenter occurs? I've tried using .stop( ) but no matter which two boolean parameters I enter for it, it doesn't help.
My current code looks like this. This causes non-stop flashing of the alt. td element.
$('#cap').bind('mouseenter', function( ) {
$('#cap').hide(
1
,function( ) {
[Code].....
View 2 Replies
View Related
Apr 12, 2010
I would like to display an image and on moueover or mouseenter want to fade the pic completely to show a div with text in it.
On mouseleave would like to unfade the pic to now hide the text.
Here is what I have so far the mouseenter works but the last part not so much. I ultimately am planning on having 4 different images and text divs on the same page
<html>
View 1 Replies
View Related
Apr 18, 2011
I want to do like that, I have a center point, when I hover mouse to left of that point, slider will move left and same with right
var margin = $("#viewer").offset().left;
padding = $("#viewer").width()/2,
m = margin+padding;
$("#viewer").mouseenter(function(e) {
var te = m-e.pageX;
$('#slide').animate({left:"-="+te+"px"}) ;
});
And
<div id="viewer">
<div id="slide">
<img id="image1" class="current" src="21.jpg" alt="Amstrad CPC 472">
<img id="image2" src="45ew645f4sa.jpg" alt="Atari TT030">
<img id="image3" src="4h54df54hg5a.jpg" alt="Commodore 64">
<img id="image4" src="46eg.jpg" alt="Commodore 128">
<img id="image5" src="4w54erwe.jpg" alt="Sinclair ZX Spectrum +2">
</div></div>
But, it only move left / right one time. So, how can div slider automatic move left (while mouse still hover viewer) forever until my mouse out of viewer.
View 1 Replies
View Related
Jun 12, 2011
What I want to do basically is to replicate functionaly from jquery forum. While browising forum list you may notice that small menu popup on right side. I want to do something similiar on my forums, and siplay some small menu for each thread and post. Now what I need is way to do it in table cell.
$(document).ready(function () {
$(function () {
$('.thread-name').mouseenter(function () {
$('.thread-row-actions').show()
[Code].....
I come up with this. But is cealry not working, as it display all menus for every cell, which is not what I want.
View 1 Replies
View Related
Feb 17, 2010
how to fire the mouseenter event programaticaly when link in gridview row is selected?
View 3 Replies
View Related
Aug 2, 2011
This seemingly simple line of code: jQuery('div#space-for-' + institutionId).html(data); works fine in Chrome and FireFox, but does not result in placing the "data" HTML content in the selected div. Nothing at all changes on the page when in IE8. I've tested in jQuery-1.4.2 and jQuery-1.6.2 with identical results.
View 1 Replies
View Related
Apr 30, 2010
why this
Code:
$('#div1').html($('.div2').html()); doesn't work in IE, but this does?
Code:
document.getElementById('div1').innerHTML = $('.div2').html(); both work fine in FF and others, but not in IE??????
View 6 Replies
View Related
Jul 12, 2011
$(function() {
window.resizeTo(925,10000);
$('input').removeAttr('checked')
var feedback = "Your Results: ";
$(".yes").click(function () {var feedback = feedback + $(this).html();
$(this).parent().next("p").show("fast"); });
$(".no").click(function () { $(this).parent().next("p").next("p").show("fast"); });
[Code]...
View 3 Replies
View Related
May 16, 2011
I found jQuery simply amazing and been using this since then. My first and current version that I use is 1.4.2. My code below works fine in 1.4.2 until I upgraded to 1.6.1. I'm using CI for my php,btw.$("#ResultPanel").html(ajax_load).load("irs/login"+"#div_One"); After I upgraded to 1.6.1 Firebug reports "404 Page Not Found. The page you requested was not found". But when I switch back to 1.4.2 it works fine again. When I read the 1.6.1 release note it only says .attr() and prop() method nothing that I understand about .load().
my code that no longer supported in 1.6.1 released?
View 10 Replies
View Related
Oct 19, 2009
I have this function:
<script language="javascript">
$(document).ready(function()
{
$("#place").change(function()
[code]....
I does work fine on firefox.. but as normal on IE does not load the result form types.php... .html(data) is not showing up.
View 1 Replies
View Related
Jan 13, 2011
I'm using jQuery UI to enhance the look of my web app. One of my button has an Html.ActionLink in it. The Html should be returned as ananchor element. The button responds ONLY when the words in the button are clicked. If I click out side the words (but still inside the button) nothing happens. This is the jQuery code is:
$(".edit-button").button({ icons: { primary: "ui-icon-pencil"} });
I think I'm missing some jquery call to get the button to be connected to the html helper.
View 1 Replies
View Related
Nov 15, 2010
It invovles changing the html using jQuery when the browser is less than IE9
I was messing with the .html() jQueryfunctionthat Ihaveused before and was having some problems With this code, it runs in all browsers:
<!DOCTYPE html>
<html lang="en">
<head>
<meta charset="utf-8" />
[Code]....
View 1 Replies
View Related
Aug 25, 2010
I got an ajax that creates an image tag whenever a drop down for car brand is clicked, it works well in firefox and internet explorer, but doesn't show on safari and chrome The ajax:
[Code].....
View 1 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Oct 20, 2010
I've used to an AJAX call to load a HTML table into div. This is working successfully. I know want to use a click event on buttons located within the inserted table.
The click event is triggering on buttons outside the inserted table but not on the buttons within the table.
Do I need to call some sort of refresh function to so that jQuery is able to pick up these events?
View 1 Replies
View Related
Aug 8, 2011
I have a <Html> Table with so Many <li> elements. SO when I export the html table to excel the cells are incrementing when ever it encounters <li> I want them to increment only when they encounter <th><td> Here is my jquery
[Code]....
View 2 Replies
View Related
Oct 19, 2010
i am doing the JavaScript code But my code is not running please have a look onc code sirnow i am trying the button click then not workingMy Code is BelowPage.html
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml">
[code]....
View 5 Replies
View Related
Mar 16, 2010
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
View 5 Replies
View Related
