why this
Code:
$('#div1').html($('.div2').html()); doesn't work in IE, but this does?
Code:
document.getElementById('div1').innerHTML = $('.div2').html(); both work fine in FF and others, but not in IE??????
It invovles changing the html using jQuery when the browser is less than IE9
I was messing with the .html() jQueryfunctionthat Ihaveused before and was having some problems With this code, it runs in all browsers:
<!DOCTYPE html>
<html lang="en">
<head>
<meta charset="utf-8" />
[Code]....
I have a <Html> Table with so Many <li> elements. SO when I export the html table to excel the cells are incrementing when ever it encounters <li> I want them to increment only when they encounter <th><td> Here is my jquery
[Code]....
Im currently working on a project with jquery... the thing is.. i need to change the contents of a div named "sub2" with the contents of "pets.html"... i've read some tutorials and i thought the best way to do this is through the use of jquery...
Here's my code:
My image which is supposed to be clicked contains this:
The code is working ., but when i transfer my codes to netbeans with Tomcat running the code didnt work ...
Is there anyone here who knows what's wrong or what should i do with my code?
I have just started learning JQuery and have a doubt in the below code. $.get('myhtmlpage.html', myCallBack);The doubt is should the 1st parameter of the get function be a HTML file or can it be a unction name?
View 1 Replies View RelatedI'm building a webpage using javascript and iframes. Basically I have an iframe in the middle of the index.html page that links to another html page (let's call it iframe.html). My question is, is it possible to call a javascript function from iframe.html to control an object on index.html? If so, how do I do this? I'd like to be able to assign an image in iframe.html with the hyperlink of href="javascript:function()", where the function effects the CSS of a div on index.html.
View 2 Replies View RelatedThis seemingly simple line of code: jQuery('div#space-for-' + institutionId).html(data); works fine in Chrome and FireFox, but does not result in placing the "data" HTML content in the selected div. Nothing at all changes on the page when in IE8. I've tested in jQuery-1.4.2 and jQuery-1.6.2 with identical results.
View 1 Replies View Related$(function() {
window.resizeTo(925,10000);
$('input').removeAttr('checked')
var feedback = "Your Results: ";
$(".yes").click(function () {var feedback = feedback + $(this).html();
$(this).parent().next("p").show("fast"); });
$(".no").click(function () { $(this).parent().next("p").next("p").show("fast"); });
[Code]...
I found jQuery simply amazing and been using this since then. My first and current version that I use is 1.4.2. My code below works fine in 1.4.2 until I upgraded to 1.6.1. I'm using CI for my php,btw.$("#ResultPanel").html(ajax_load).load("irs/login"+"#div_One"); After I upgraded to 1.6.1 Firebug reports "404 Page Not Found. The page you requested was not found". But when I switch back to 1.4.2 it works fine again. When I read the 1.6.1 release note it only says .attr() and prop() method nothing that I understand about .load().
my code that no longer supported in 1.6.1 released?
I have this function:
<script language="javascript">
$(document).ready(function()
{
$("#place").change(function()
[code]....
I does work fine on firefox.. but as normal on IE does not load the result form types.php... .html(data) is not showing up.
I'm using jQuery UI to enhance the look of my web app. One of my button has an Html.ActionLink in it. The Html should be returned as ananchor element. The button responds ONLY when the words in the button are clicked. If I click out side the words (but still inside the button) nothing happens. This is the jQuery code is:
$(".edit-button").button({ icons: { primary: "ui-icon-pencil"} });
I think I'm missing some jquery call to get the button to be connected to the html helper.
I am supposed to change the text of a <div> when the mouse is hovered above it. When the mouse leave the <div> tag the text has to get back to old text. What is happening is in mouseenter() if i give as $("div").html("<a href =>hello world</a>"); then the text of the div tag changes to hello world bith hyperlink but then when the mouse leaves the div then the mouseleave() event is not triggered. Instead of having the line mentioned above if suppose i have it as $("div").text("<a href hello world</a>"); then the text of div changes to the complete string in the quotes and the mouseleave() event is also triggered. I am supposed to render the html format so am i missing something or do i need to do something else.
View 1 Replies View RelatedI got an ajax that creates an image tag whenever a drop down for car brand is clicked, it works well in firefox and internet explorer, but doesn't show on safari and chrome The ajax:
[Code].....
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
I've used to an AJAX call to load a HTML table into div. This is working successfully. I know want to use a click event on buttons located within the inserted table.
The click event is triggering on buttons outside the inserted table but not on the buttons within the table.
Do I need to call some sort of refresh function to so that jQuery is able to pick up these events?
i am doing the JavaScript code But my code is not running please have a look onc code sirnow i am trying the button click then not workingMy Code is BelowPage.html
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml">
[code]....
I have a master.html where i have navigationDIV and bodyDIV, and on every click of nav tabs i am loading external html page into bodyDiv using following .load() function. $('#bodyDiv').load('home.html') Now I have some basic JQuery functions in external JS file which i have linked in master pagewhere i am using toggleSlide(), hide(), addClass() so and so forth, first time when page is getting load all these functions are working alright but the moment i am loading another tab page all functions stop working even on first tab also. Tab onClick script from where .load() function is getting fired:
<li id="one"><a href="#first" onclick="javascript:$('#bodyDiv').load('home.html')" >Home</a></li>
<li id="two"><a href="#second" onclick="javascript:$('#bodyDiv').load('trade.html')" >Trading</a></li>
Note FYI: I have used Jquery Tab UI on this page, the scrip is as below:
[Code]...
I want to jquery to add to an <ul> list I have. The list already has one list item in it and I just want to carry on adding to it. I've tried copying some jquery html examples but I can't seem to get it to work. [code]but from what I understand, what you put in front of the .html is replaced with what you include after but that doesn't appear to be how this example is work. Also this adds to a div, can I not add to a li?
View 3 Replies View RelatedI Use the regular expression to find the html tags present in the input box, It works properly in IE & FF but in chrome it works fine when use first time for an input box but not again, below my code...
function IsWithinTags(inputString) {var regExp = /</?[^>]+(>|$)/g;
inputString = inputString.replace(/&(lt|gt);/g, function (strMatch, p1) {
return (p1 == "lt") ? "<" : ">";
});
[Code]....
Ok, the title might not be a very good title, but I'll try to explain a little better INSIDE the post Ok, so here is my example jQuery
$(document).ready(function(){
$('#holder').html('<a href="#" id="foo">Hey!</div>');
$('#foo').click(function(){
[code]....
I stumbled upon something which may be by design in jQuery for security reasons, it may be the browsers doing it, but... I found that any JavaScript I try to put into the html of an object is ignored. For example, say username is a variable that was already defined with the user's name:
$("#test").html("Hi there <script type='text/
javascript'>document.write(username);</script>.
");
All the script is just stripped out, in both IE and Firefox.
I am using a GET function to process an external file, but I need only part of it.
[Code]...
So how to 'process' html : e.g. how to remove a certain div inside the html ?
I have a button that when clicked, I want to change the content of a DIV. Please see my code below. I'm connecting to the library as I'm using a few others bits and pieces of jQuery.
Code JavaScript:
$(document).ready(function(){
function addtoBasket(id){[code]......
I want to create a questions creation page. It has a Question Text Box and a Add Button.When users press the add button, there will be a newQuestion Text Box and a new Add Button appear in the next line. But the old Add Button will become a Delete Button and change its functionality.[code]I put all the Add Buttons and Minus Buttons into two different classes, ".buttonPlus" and ".buttonMinus".The .buttonPlus works well when the line is added by the main html. But it fails to work when it is added by the .append() function. It simply adds the .buttonPlus's CSS code to its button, but the$(".buttonPlus").click(function (event) {...} is NOT attached to the new buttonPlus.
View 1 Replies View RelatedI use the html() function for my dialog system, and this function changes the html code...
Example :
$("#jquery_dialog").html(content_html);
alert(content_html);
alert($("#jquery_dialog").html());
The reply is :
Alert:
<form method="post" action="traitement.php">
<select name="select">
[...]
</select><br />
<input type="text" name="text" />
[...]
</form>
<script>
/* jQuery code */
</script>
Alert:
<form method="post" action="traitement.php"></form>
<select name="select">
[...]
</select><br>
<input type="text" name="text" />
[...]
We can see, the code has been modified by html() function...How I can do for insert code without modification??
I have some basic functions to animate something, but they only seem to work in FF, Safari, Opera... but of course not in IE 6.0. I don't know what I'm doing wrong, yet. Tried adding the DTD doctype etc... nothing changes.
Demo right here
<html><head> <title>test</title>
<script
type="text/javascript"
src="js/jquery-1.4.2.min.js"
></script
>
<script
type="text/javascript"
src="js/jquery-ui-1.8.2.min.js"
></script
> .....