JQuery :: Cannot Seem To Get These Two Scripts Working In The Same Page?
Oct 19, 2011
i know this question has been asked before. the thing is (although explained very clearly in similar posts) i cannot seem to get these two scripts working in the same page.a working version?script 1:
<link href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/themes/base/jquery-ui.css" rel="stylesheet" type="text/css"/>
<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.5/jquery.min.js"></script>
[code].....
View 7 Replies
ADVERTISEMENT
Apr 12, 2011
I have the following bit of jQuery:
Code:
$("#save_photos_all_continue").click(function() {
event.preventDefault();
var $black_white_all = $("#black_white_all").is(':checked');
var $color_all = $("#color_all").is(':checked');
var $other_all = $("#other_all").is(':checked');
[Code]...
In Google Chrome it works fine but in Mozilla/5.0 it actually goes to the save_edits page instead of just using the post and staying on the original page.
View 2 Replies
View Related
Apr 7, 2010
I have a html document with some jquery which is working fine...i pasted the same code in aspx page but its not working properly...i am not able to make out where the problem lies...
View 3 Replies
View Related
Oct 25, 2011
The download functionality is not working. If i try the Quick Downloads link it either brings me to a page that displays gibberish (trying to display the .zip) or if it actually allows me to download the .zip it is corrupt.When i try to custom the download and I click download it just redirects me back to the page and nothing happens
View 1 Replies
View Related
Feb 20, 2009
I cannot get two of my three jquery sliders to work on my page. I have three in total the first one works perfectly.. but the second two do not I have checked and double checked but cannot see the issue. The 2nd and 3rd do not display but their buttons prev and next are displayed.. the web address is Site Example
[Code]....
View 9 Replies
View Related
Feb 9, 2011
I've been working on building a site and I was styling a form via css when I realised after I finished that the jquery I'd spent the day working for some reason has stopped functioning.When I say stopped functioning I mean selectors work, classes applied via css etc work, things are working but transitions via coda slider and jflow plus i've put in aren't coming in for no explicable reason. Atleast to me, its frustrating having spent a bit of time working on these respectively. When I check it in firebug the 'slides' change and when I close firebug it switches back in jflow and coda just isn't working but css styles are being applied. I'm really hoping this is something my end rather than a screw up somewhere, I can't see what I would of done though just by editing CSS.
The site is http:[url]...
View 3 Replies
View Related
Sep 10, 2009
Newbie to JQuery Datepicker here. I'm trying to use it in an ASP.NET C# form content page with no luck. I've even tried moving the scripts to the Master page, even though I'd prefer to just use it on a few content pages. Below is my code. Could someone please show me what code changes I need to make to get this working?
[Code]...
View 2 Replies
View Related
Jun 13, 2011
I seem to be have a problem getting a date picker to work in an asp.net mvc3 page.
It works fine in a regular HTML page IE[code]..
View 2 Replies
View Related
Jul 22, 2010
I have a page which has large contents. If I open the dialog when page is has been opened, the dialog is fine and it closes well. Now, If I have opened my main page and scrool down to page and at the end there is a link for opening dialog, then the dialog opens to current window position and page is scrolled up to top. Now dialog has been opened but it is too below that I cant see it. I have tested that when we scroll down the jquery function takes the scrooled position as its top position and so opening popup for that relative position.
My code is.
$dialog.dialog({
title: title,
autoOpen: true,
width: width,
height: height,
modal: true,
resizable: true,
autoResize: false,
position: [0,0],
overlay: {
opacity: 0.3,
background: "black"
}}).width(eval(eval(width) - horizontalPadding)).height(eval(eval(height) - verticalPadding));
How I can open it on top of page?
View 1 Replies
View Related
Jan 10, 2012
I have a working version of a jQuery image slider that can be seen here. I am trying to implement this into a new website and have copied the code exactly but for some reason the images are not rotating or switching when the thumbnails are clicked. The new slider can be see here - I have it in a test page so that there is no possibility of any other scripts conflicting.
View 2 Replies
View Related
Jul 22, 2011
So I just finished developing a big app in FF, Chrome adn Safari where everything works great. I switched to IE expecting maybe a few bugs, but almost NONE of my jQuery works. Just to test I put together a simple page to test basic jQuery and it still doesn't work:
[Code]...
I just have a hidden div on my page and want to show it and it doesn't work.
View 7 Replies
View Related
Jul 23, 2009
I am trying use the Load function and it looks partly succesful:the script code is:
function doCallBack(action, value)
{
if (action == 'projlokatiemutaties')
[code]....
Projectlokaties1 contains an XML control and the content is being transformed using Xslt. As far as I can see the html variable contains
the correct value. However the Response.Write() operations fails completely. As a matter of fact at this point any Response operation fails.
View 1 Replies
View Related
Sep 1, 2010
Probably an easy one, I have the following code...
[Code]...
However whenever I click on the link it still goes to the top of the page.
View 1 Replies
View Related
Jun 22, 2009
I'm using tablesorter plugin with the pager plugin. I created a row hover function because I couldn't get the tablesorter rowhover to work. This one works on the first page of the table but subsequent pages don't get the function (assigning the class) applied.
This is my function:$(document).ready
(
function()
{
$('#tablesorter tr').hover
[Code].....
View 3 Replies
View Related
May 8, 2010
I wrote this small page and for some reason when I click on the submit nothing happens (checked on firebug, no submit is happening)
<html><head>
<script type="text/javascript" src="jquery-1.4.2.min.js"></script>
<script type="text/javascript">
$('form#login').submit(function() {
$.ajax({
type: 'POST',
url: '[URL]',
data: this.html(data),
success: success,
dataType: dataType
})});
</script>
</head><body>
<form action="#" id="login">
<input type="textbox" id="UserName" value="user">
<input type="textbox" id="Password" value="password">
<input type="submit" value="submit">
</form></body></html>
View 1 Replies
View Related
Oct 22, 2009
I want create a page which has animation at the bottom of that page. I use jQuery to do that. This is the way I do it
<a href="#" class="animation">Animate this</a>
And this is the jquery
$(document).ready(function() {
$('a.animation').click(function(e) {
e.preventDefault();
//animation goes here;
});
});
When I run the code, all animation run very well except the page always scroll to the top. I try to change the href attribute to javascript:void(0); but it still run like that..
View 5 Replies
View Related
Feb 7, 2011
I'm helping out a dev at my work who is having a problem.as a function to where it should scollTo (using scrollTo plugin) on page load to the starting "page". I don't think it is a plugin problem though. It only loads correctly about half the time, but if you hit refresh it will work?Can anyone tell me why this is? It's like it doesnt execute it everytime the page loads
View 2 Replies
View Related
Nov 4, 2011
I'm recently reading through 'jQuery Fundamentals', and had a few questions about JSON.
I have the following JSON:
I wanted to , so I did:
Where weather corresponds to the JSON, and $ul, the unordered list element.
This works fine, however I'm unsure if this is the correct way of accessing that specific value in the JSON, as well as adding it to my page.
Does this mean that when manipulating a large piece of JSON, with many nested levels, you'll have to use many $.each's inside of $.each's?
View 2 Replies
View Related
Aug 9, 2010
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflictingTo test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
[code]....
View 2 Replies
View Related
Oct 30, 2009
I am not a guru jquery coder and still have to learn alot, recently while learning jquery AJAX I have bumped into a weired issue, I have a apge right and in this page I have a dropdown list for people to select an RSS channel that they wish to know more about, the dropdownlist ahs an onChange event which when triggered it will get the value of the selected item in teh dropdownlist and post it to the other 'mini' pages that load on the same page via AJAX by using the GET method - ie: im passing the parameters like a normal querystring would. The problem is that when I assign the dropdown value to a variable called dropdown in the following line of code "var dropdown =document.getElementById('ddlChannelSelect');" it works in IE but not in the other browsers, I have debbugged this in FireBug and it seems that the variable dropdownlist is not actually getting the value of the actual dropdownlist nad it says 'null' or sometimes 'undefined'. Am I doing something wrong ? why is it that it is working in IE but not in other browsers ? can you pls give me a solution with some examples ?
[Code]...
View 4 Replies
View Related
Jun 12, 2011
I have two drop-down listboxes on a page. One listbox is visible and named sParent the other is suppose to be hidden and is named sChild. There are only 2 option values in the sParent listbox and they are vParent and vChild. If the user chooses the vChild option from the sParent listbox, than the second listbox named sChild is suppose to become visible, but if the users chooses any other option value or no option value at all from the sParent listbox the sChild listbox is to remain hidden. Below is the jquery code I am using, and below that is my html code:
View 2 Replies
View Related
May 31, 2011
I am trying to get contents of a page into a popup div when user clicks on the View sample plan link in the table with the id='plans' below.
I will change the contents of junk.php once I can get it working.
View 5 Replies
View Related
Jun 12, 2011
I use .append() and .prepend() to automatically add content to a existing html tag with id. In IE the function is working fine but when i viewed it using view source i can't see the content. When i tried it with Chrome, i can immediately see the content. Is there something i missed out?
View 1 Replies
View Related
Sep 10, 2010
I have a tab that scrolls through images in a frame through javascript. It works in one page, but not the other. I'm trying to get the page not working to work, obviously. I also have checked and temporarily fixed validation errors, and that doesn't help.
Working page: [URL]
Same images in different page: [URL]
I've been trying the "BDirect lists" on both pages. Java: "new SimpleSlide". Just when I think I am close, I can't get it to work.
View 3 Replies
View Related
Nov 17, 2011
I should start off saying I dont know the first thing about java script programming. I have 3 scripts on one of my pages, the first script is for a slide animation, the second is a hover intent script and the third is a headline animation script.
I know if I comment out the hover intent script, the first and third script work. So my question is how to get the hover intent script to work correctly and behave with the other 2 scripts on the page. I read your post on "on body load" or "runscripts" calls with 2 scripts but I could not find such calls in these 3 javascripts.
The hover intent script does not do what I want it to do on any of the pages that I have installed it on. When you first load the page the menu items are sitting above the slideshow and when you hover your mouse over the navigation from left to right they sort of jump and its not until you get to the contact image at the end that the slideshow moves into the correct position and then if you go back and hover over the home image the slideshow jumps up and down.[URL]...
View 2 Replies
View Related
Jan 6, 2010
When i click on an image, it just opens in a new tab, lightbox doesn't work?!
$jq_add_div_strings = '';
$jq_div_classes_csv = '';
$counter = 0;
[code]....
View 1 Replies
View Related
